Incidental Mutation 'R6694:Tcfl5'
ID 528482
Institutional Source Beutler Lab
Gene Symbol Tcfl5
Ensembl Gene ENSMUSG00000038932
Gene Name transcription factor-like 5 (basic helix-loop-helix)
Synonyms Figlb, FIG beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock # R6694 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 180621956-180642708 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 180622654 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 470 (S470P)
Ref Sequence ENSEMBL: ENSMUSP00000040611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037877] [ENSMUST00000103059] [ENSMUST00000132527]
AlphaFold Q32NY8
Predicted Effect probably damaging
Transcript: ENSMUST00000037877
AA Change: S470P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040611
Gene: ENSMUSG00000038932
AA Change: S470P

DomainStartEndE-ValueType
low complexity region 3 36 N/A INTRINSIC
low complexity region 76 110 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 185 198 N/A INTRINSIC
low complexity region 355 373 N/A INTRINSIC
HLH 395 445 2.13e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103059
SMART Domains Protein: ENSMUSP00000099348
Gene: ENSMUSG00000027570

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.7e-12 PFAM
Pfam:Collagen 58 114 4.2e-9 PFAM
low complexity region 126 162 N/A INTRINSIC
Pfam:Collagen 174 236 4.1e-12 PFAM
Pfam:Collagen 213 292 8e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.8e-11 PFAM
low complexity region 635 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132527
SMART Domains Protein: ENSMUSP00000128718
Gene: ENSMUSG00000027570

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.9e-12 PFAM
Pfam:Collagen 58 114 4.3e-9 PFAM
Pfam:Collagen 109 166 4.5e-8 PFAM
Pfam:Collagen 174 236 4.2e-12 PFAM
Pfam:Collagen 213 292 8.2e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 402 474 8.2e-8 PFAM
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.9e-11 PFAM
Pfam:Collagen 603 662 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165879
Meta Mutation Damage Score 0.1050 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,546 S160N probably benign Het
4930444G20Rik T C 10: 22,067,721 E120G probably damaging Het
Arap3 A C 18: 37,991,537 probably null Het
Arhgap10 A G 8: 77,411,063 F300L probably benign Het
Ccdc116 T C 16: 17,142,791 E54G probably benign Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Ctnnd1 T C 2: 84,624,505 probably benign Het
Ddx60 A G 8: 62,037,070 D1691G probably damaging Het
Dnah11 T C 12: 118,186,882 probably null Het
Exoc1 T A 5: 76,549,552 M392K probably damaging Het
Exoc3l G C 8: 105,290,490 R622G probably benign Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Kif20a A G 18: 34,625,526 E16G probably damaging Het
Kit T C 5: 75,640,757 V568A possibly damaging Het
Lhx4 T C 1: 155,704,710 S257G probably benign Het
Med18 C T 4: 132,459,982 V114I probably benign Het
Mrps30 C T 13: 118,386,961 V92M possibly damaging Het
Mtrr C T 13: 68,564,333 V645I probably benign Het
Nuak2 T G 1: 132,332,310 S609A probably damaging Het
Olfr1393 A T 11: 49,280,552 I135F probably benign Het
Plk4 T C 3: 40,801,828 V58A probably damaging Het
Polq T A 16: 37,015,173 F145L probably null Het
Rab11fip2 T C 19: 59,937,275 K170R probably damaging Het
Rapgef3 A G 15: 97,759,984 V246A probably benign Het
Rc3h2 A G 2: 37,400,543 S316P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 GCGGCGGC GCGGCGGCGACGGCGGC 7: 97,579,928 probably benign Het
Sae1 G T 7: 16,368,536 A171E probably damaging Het
Setd5 T A 6: 113,143,708 N959K probably benign Het
Siae T A 9: 37,616,823 Y31N probably damaging Het
Sit1 C T 4: 43,483,311 G51D probably damaging Het
Slc5a11 A G 7: 123,267,789 I436V possibly damaging Het
Timd2 A T 11: 46,670,952 C288* probably null Het
Timeless T G 10: 128,239,999 probably null Het
Ubxn8 G T 8: 33,621,544 Q274K possibly damaging Het
Usp29 A G 7: 6,962,277 E373G probably benign Het
Zap70 A G 1: 36,782,517 Y597C probably damaging Het
Zfp523 T G 17: 28,200,472 Y195D probably damaging Het
Zfp74 G A 7: 29,935,134 A383V probably damaging Het
Zfp93 A T 7: 24,275,913 Q441L probably damaging Het
Zfp976 A T 7: 42,614,186 Y76N probably damaging Het
Other mutations in Tcfl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02799:Tcfl5 UTSW 2 180638626 missense possibly damaging 0.94
R1238:Tcfl5 UTSW 2 180622647 missense probably benign 0.29
R5748:Tcfl5 UTSW 2 180642257 synonymous silent
R6679:Tcfl5 UTSW 2 180635262 missense probably damaging 1.00
R7293:Tcfl5 UTSW 2 180642165 missense probably benign 0.08
R8284:Tcfl5 UTSW 2 180638537 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGCTCTCAACGTCCTTACTGG -3'
(R):5'- AGTGTACATGTCTGTGATACCTTAG -3'

Sequencing Primer
(F):5'- TTACTGGAGTCCCACAACTGGAG -3'
(R):5'- CATGTCTGTGATACCTTAGAAGACTG -3'
Posted On 2018-07-24