Incidental Mutation 'R6694:Plk4'
ID 528483
Institutional Source Beutler Lab
Gene Symbol Plk4
Ensembl Gene ENSMUSG00000025758
Gene Name polo like kinase 4
Synonyms Stk18, Sak
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6694 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 40800019-40816883 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40801828 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 58 (V58A)
Ref Sequence ENSEMBL: ENSMUSP00000144693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026858] [ENSMUST00000167556] [ENSMUST00000203295] [ENSMUST00000203895] [ENSMUST00000204473]
AlphaFold Q64702
Predicted Effect probably damaging
Transcript: ENSMUST00000026858
AA Change: V57A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026858
Gene: ENSMUSG00000025758
AA Change: V57A

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 774 6e-41 PDB
low complexity region 820 831 N/A INTRINSIC
Pfam:POLO_box 849 910 7e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167556
AA Change: V57A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126945
Gene: ENSMUSG00000025758
AA Change: V57A

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 551 771 6e-41 PDB
low complexity region 817 828 N/A INTRINSIC
Pfam:POLO_box 844 908 1.6e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203295
AA Change: V57A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145277
Gene: ENSMUSG00000025758
AA Change: V57A

DomainStartEndE-ValueType
S_TKc 12 265 3.46e-100 SMART
low complexity region 288 312 N/A INTRINSIC
low complexity region 329 341 N/A INTRINSIC
PDB:4G7N|B 554 747 3e-32 PDB
low complexity region 793 804 N/A INTRINSIC
Pfam:POLO_box 822 883 6.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203320
Predicted Effect probably damaging
Transcript: ENSMUST00000203895
AA Change: V57A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145455
Gene: ENSMUSG00000025758
AA Change: V57A

DomainStartEndE-ValueType
STYKc 12 143 3.5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204289
Predicted Effect probably damaging
Transcript: ENSMUST00000204473
AA Change: V58A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144693
Gene: ENSMUSG00000025758
AA Change: V58A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 13 114 4.9e-17 PFAM
Pfam:Pkinase 13 115 2.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205046
Meta Mutation Damage Score 0.6461 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: This gene encodes a member of the polo family of serine/threonine protein kinases. The protein localizes to the nucleolus during G2, to centrosomes during G2/M, and to the cleavage furrow during cytokinesis. It is required for progression through mitosis, cell survival, and embryonic development. The mouse genome contains a pseudogene similar to this gene. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for disruptions of this gene die before birth. Development is arrested around E7.5. Mice heterozygous for an ENU-induced allele or gene trap alele exhibit male hypogonadism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,546 S160N probably benign Het
4930444G20Rik T C 10: 22,067,721 E120G probably damaging Het
Arap3 A C 18: 37,991,537 probably null Het
Arhgap10 A G 8: 77,411,063 F300L probably benign Het
Ccdc116 T C 16: 17,142,791 E54G probably benign Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Ctnnd1 T C 2: 84,624,505 probably benign Het
Ddx60 A G 8: 62,037,070 D1691G probably damaging Het
Dnah11 T C 12: 118,186,882 probably null Het
Exoc1 T A 5: 76,549,552 M392K probably damaging Het
Exoc3l G C 8: 105,290,490 R622G probably benign Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Kif20a A G 18: 34,625,526 E16G probably damaging Het
Kit T C 5: 75,640,757 V568A possibly damaging Het
Lhx4 T C 1: 155,704,710 S257G probably benign Het
Med18 C T 4: 132,459,982 V114I probably benign Het
Mrps30 C T 13: 118,386,961 V92M possibly damaging Het
Mtrr C T 13: 68,564,333 V645I probably benign Het
Nuak2 T G 1: 132,332,310 S609A probably damaging Het
Olfr1393 A T 11: 49,280,552 I135F probably benign Het
Polq T A 16: 37,015,173 F145L probably null Het
Rab11fip2 T C 19: 59,937,275 K170R probably damaging Het
Rapgef3 A G 15: 97,759,984 V246A probably benign Het
Rc3h2 A G 2: 37,400,543 S316P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 GCGGCGGC GCGGCGGCGACGGCGGC 7: 97,579,928 probably benign Het
Sae1 G T 7: 16,368,536 A171E probably damaging Het
Setd5 T A 6: 113,143,708 N959K probably benign Het
Siae T A 9: 37,616,823 Y31N probably damaging Het
Sit1 C T 4: 43,483,311 G51D probably damaging Het
Slc5a11 A G 7: 123,267,789 I436V possibly damaging Het
Tcfl5 A G 2: 180,622,654 S470P probably damaging Het
Timd2 A T 11: 46,670,952 C288* probably null Het
Timeless T G 10: 128,239,999 probably null Het
Ubxn8 G T 8: 33,621,544 Q274K possibly damaging Het
Usp29 A G 7: 6,962,277 E373G probably benign Het
Zap70 A G 1: 36,782,517 Y597C probably damaging Het
Zfp523 T G 17: 28,200,472 Y195D probably damaging Het
Zfp74 G A 7: 29,935,134 A383V probably damaging Het
Zfp93 A T 7: 24,275,913 Q441L probably damaging Het
Zfp976 A T 7: 42,614,186 Y76N probably damaging Het
Other mutations in Plk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Plk4 APN 3 40801789 missense probably damaging 1.00
IGL01730:Plk4 APN 3 40805850 missense probably benign 0.00
IGL01906:Plk4 APN 3 40810381 missense probably null 0.01
IGL02021:Plk4 APN 3 40810708 missense probably damaging 0.97
IGL02718:Plk4 APN 3 40815021 missense probably damaging 1.00
IGL03287:Plk4 APN 3 40805118 missense probably benign 0.11
R0058:Plk4 UTSW 3 40805872 missense probably benign
R0058:Plk4 UTSW 3 40805872 missense probably benign
R0312:Plk4 UTSW 3 40813547 missense probably damaging 0.97
R0387:Plk4 UTSW 3 40812884 splice site probably benign
R0411:Plk4 UTSW 3 40811219 unclassified probably benign
R0480:Plk4 UTSW 3 40805640 missense probably benign 0.15
R1170:Plk4 UTSW 3 40801847 missense probably damaging 1.00
R1268:Plk4 UTSW 3 40811369 missense probably damaging 1.00
R1529:Plk4 UTSW 3 40806536 missense probably benign 0.09
R1987:Plk4 UTSW 3 40805817 missense possibly damaging 0.60
R1988:Plk4 UTSW 3 40805817 missense possibly damaging 0.60
R2050:Plk4 UTSW 3 40810380 missense probably benign
R4409:Plk4 UTSW 3 40806549 missense probably damaging 0.98
R4727:Plk4 UTSW 3 40805154 missense probably benign 0.00
R4765:Plk4 UTSW 3 40802022 missense probably damaging 1.00
R4772:Plk4 UTSW 3 40805190 missense probably damaging 1.00
R5022:Plk4 UTSW 3 40802077 splice site probably null
R5363:Plk4 UTSW 3 40801984 missense possibly damaging 0.71
R5651:Plk4 UTSW 3 40813505 missense probably benign 0.00
R5665:Plk4 UTSW 3 40813586 missense possibly damaging 0.79
R5724:Plk4 UTSW 3 40801046 missense probably damaging 1.00
R6391:Plk4 UTSW 3 40808973 missense probably benign 0.05
R7412:Plk4 UTSW 3 40812178 missense probably benign
R8047:Plk4 UTSW 3 40805752 missense probably benign
R8165:Plk4 UTSW 3 40813574 missense probably damaging 0.99
R8399:Plk4 UTSW 3 40808830 nonsense probably null
R8411:Plk4 UTSW 3 40813466 missense probably benign
R8724:Plk4 UTSW 3 40813587 missense probably damaging 0.97
R9222:Plk4 UTSW 3 40806555 missense possibly damaging 0.94
R9294:Plk4 UTSW 3 40811891 missense probably damaging 1.00
R9573:Plk4 UTSW 3 40808822 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACTCTGTTAGGTCGAGGGC -3'
(R):5'- GCACATTTCCAATACCAGGTAG -3'

Sequencing Primer
(F):5'- GCACAGATAGGAGTAAACTGACTTC -3'
(R):5'- TTTCCAATACCAGGTAGACATAATTG -3'
Posted On 2018-07-24