Incidental Mutation 'R6694:Cd53'
ID 528484
Institutional Source Beutler Lab
Gene Symbol Cd53
Ensembl Gene ENSMUSG00000040747
Gene Name CD53 antigen
Synonyms Tspan25, Ox-44
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock # R6694 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 106759921-106790149 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 106767386 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 122 (I122F)
Ref Sequence ENSEMBL: ENSMUSP00000035781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038845]
AlphaFold Q61451
Predicted Effect probably benign
Transcript: ENSMUST00000038845
AA Change: I122F

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000035781
Gene: ENSMUSG00000040747
AA Change: I122F

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 210 4.6e-54 PFAM
Meta Mutation Damage Score 0.2382 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. It contributes to the transduction of CD2-generated signals in T cells and natural killer cells and has been suggested to play a role in growth regulation. Familial deficiency of this gene has been linked to an immunodeficiency associated with recurrent infectious diseases caused by bacteria, fungi and viruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: B cells lacking this gene exhibit impaired PKC recruitment to the plasma membrane and phosphorylation of PKC substrates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,546 S160N probably benign Het
4930444G20Rik T C 10: 22,067,721 E120G probably damaging Het
Arap3 A C 18: 37,991,537 probably null Het
Arhgap10 A G 8: 77,411,063 F300L probably benign Het
Ccdc116 T C 16: 17,142,791 E54G probably benign Het
Ctnnd1 T C 2: 84,624,505 probably benign Het
Ddx60 A G 8: 62,037,070 D1691G probably damaging Het
Dnah11 T C 12: 118,186,882 probably null Het
Exoc1 T A 5: 76,549,552 M392K probably damaging Het
Exoc3l G C 8: 105,290,490 R622G probably benign Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Kif20a A G 18: 34,625,526 E16G probably damaging Het
Kit T C 5: 75,640,757 V568A possibly damaging Het
Lhx4 T C 1: 155,704,710 S257G probably benign Het
Med18 C T 4: 132,459,982 V114I probably benign Het
Mrps30 C T 13: 118,386,961 V92M possibly damaging Het
Mtrr C T 13: 68,564,333 V645I probably benign Het
Nuak2 T G 1: 132,332,310 S609A probably damaging Het
Olfr1393 A T 11: 49,280,552 I135F probably benign Het
Plk4 T C 3: 40,801,828 V58A probably damaging Het
Polq T A 16: 37,015,173 F145L probably null Het
Rab11fip2 T C 19: 59,937,275 K170R probably damaging Het
Rapgef3 A G 15: 97,759,984 V246A probably benign Het
Rc3h2 A G 2: 37,400,543 S316P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 GCGGCGGC GCGGCGGCGACGGCGGC 7: 97,579,928 probably benign Het
Sae1 G T 7: 16,368,536 A171E probably damaging Het
Setd5 T A 6: 113,143,708 N959K probably benign Het
Siae T A 9: 37,616,823 Y31N probably damaging Het
Sit1 C T 4: 43,483,311 G51D probably damaging Het
Slc5a11 A G 7: 123,267,789 I436V possibly damaging Het
Tcfl5 A G 2: 180,622,654 S470P probably damaging Het
Timd2 A T 11: 46,670,952 C288* probably null Het
Timeless T G 10: 128,239,999 probably null Het
Ubxn8 G T 8: 33,621,544 Q274K possibly damaging Het
Usp29 A G 7: 6,962,277 E373G probably benign Het
Zap70 A G 1: 36,782,517 Y597C probably damaging Het
Zfp523 T G 17: 28,200,472 Y195D probably damaging Het
Zfp74 G A 7: 29,935,134 A383V probably damaging Het
Zfp93 A T 7: 24,275,913 Q441L probably damaging Het
Zfp976 A T 7: 42,614,186 Y76N probably damaging Het
Other mutations in Cd53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02500:Cd53 APN 3 106768826 missense probably damaging 1.00
IGL02592:Cd53 APN 3 106763285 missense probably damaging 1.00
R0090:Cd53 UTSW 3 106767409 missense possibly damaging 0.94
R0392:Cd53 UTSW 3 106763276 missense probably damaging 1.00
R0538:Cd53 UTSW 3 106762128 missense probably benign 0.07
R1452:Cd53 UTSW 3 106768959 missense probably damaging 1.00
R1693:Cd53 UTSW 3 106768889 missense possibly damaging 0.66
R2042:Cd53 UTSW 3 106767424 critical splice acceptor site probably null
R2300:Cd53 UTSW 3 106763256 missense probably benign
R2878:Cd53 UTSW 3 106767416 missense probably benign 0.00
R4081:Cd53 UTSW 3 106762145 missense probably benign
R6180:Cd53 UTSW 3 106767364 missense probably damaging 0.96
R6519:Cd53 UTSW 3 106762145 missense probably benign 0.00
R7043:Cd53 UTSW 3 106763261 missense probably damaging 1.00
R7417:Cd53 UTSW 3 106768919 missense probably benign 0.17
R7736:Cd53 UTSW 3 106767936 missense probably benign 0.12
R7893:Cd53 UTSW 3 106767386 missense probably benign 0.03
R9493:Cd53 UTSW 3 106767367 missense probably null 0.66
Predicted Primers PCR Primer
(F):5'- GCCTCTGAGAGCAAAGACATTC -3'
(R):5'- TAGATCCCACATAATCCTCAGCTTC -3'

Sequencing Primer
(F):5'- AGACATTCTTTGGACTTTAGAACTG -3'
(R):5'- TCTTCTTATATAATCTCCCAAACCCC -3'
Posted On 2018-07-24