Incidental Mutation 'R6694:Med18'
ID 528486
Institutional Source Beutler Lab
Gene Symbol Med18
Ensembl Gene ENSMUSG00000066042
Gene Name mediator complex subunit 18
Synonyms 2810046C01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock # R6694 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 132458731-132463921 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 132459982 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 114 (V114I)
Ref Sequence ENSEMBL: ENSMUSP00000120535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102567] [ENSMUST00000123604]
AlphaFold Q9CZ82
Predicted Effect probably benign
Transcript: ENSMUST00000102567
AA Change: V69I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099627
Gene: ENSMUSG00000066042
AA Change: V69I

DomainStartEndE-ValueType
Pfam:Med18 19 80 1.7e-12 PFAM
Pfam:Med18 61 207 2.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123604
AA Change: V114I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120535
Gene: ENSMUSG00000066042
AA Change: V114I

DomainStartEndE-ValueType
Pfam:Med18 64 122 9.2e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MED18 is a component of the Mediator complex, which is a coactivator for DNA-binding factors that activate transcription via RNA polymerase II (Sato et al., 2003 [PubMed 12584197]).[supplied by OMIM, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,546 S160N probably benign Het
4930444G20Rik T C 10: 22,067,721 E120G probably damaging Het
Arap3 A C 18: 37,991,537 probably null Het
Arhgap10 A G 8: 77,411,063 F300L probably benign Het
Ccdc116 T C 16: 17,142,791 E54G probably benign Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Ctnnd1 T C 2: 84,624,505 probably benign Het
Ddx60 A G 8: 62,037,070 D1691G probably damaging Het
Dnah11 T C 12: 118,186,882 probably null Het
Exoc1 T A 5: 76,549,552 M392K probably damaging Het
Exoc3l G C 8: 105,290,490 R622G probably benign Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Kif20a A G 18: 34,625,526 E16G probably damaging Het
Kit T C 5: 75,640,757 V568A possibly damaging Het
Lhx4 T C 1: 155,704,710 S257G probably benign Het
Mrps30 C T 13: 118,386,961 V92M possibly damaging Het
Mtrr C T 13: 68,564,333 V645I probably benign Het
Nuak2 T G 1: 132,332,310 S609A probably damaging Het
Olfr1393 A T 11: 49,280,552 I135F probably benign Het
Plk4 T C 3: 40,801,828 V58A probably damaging Het
Polq T A 16: 37,015,173 F145L probably null Het
Rab11fip2 T C 19: 59,937,275 K170R probably damaging Het
Rapgef3 A G 15: 97,759,984 V246A probably benign Het
Rc3h2 A G 2: 37,400,543 S316P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 GCGGCGGC GCGGCGGCGACGGCGGC 7: 97,579,928 probably benign Het
Sae1 G T 7: 16,368,536 A171E probably damaging Het
Setd5 T A 6: 113,143,708 N959K probably benign Het
Siae T A 9: 37,616,823 Y31N probably damaging Het
Sit1 C T 4: 43,483,311 G51D probably damaging Het
Slc5a11 A G 7: 123,267,789 I436V possibly damaging Het
Tcfl5 A G 2: 180,622,654 S470P probably damaging Het
Timd2 A T 11: 46,670,952 C288* probably null Het
Timeless T G 10: 128,239,999 probably null Het
Ubxn8 G T 8: 33,621,544 Q274K possibly damaging Het
Usp29 A G 7: 6,962,277 E373G probably benign Het
Zap70 A G 1: 36,782,517 Y597C probably damaging Het
Zfp523 T G 17: 28,200,472 Y195D probably damaging Het
Zfp74 G A 7: 29,935,134 A383V probably damaging Het
Zfp93 A T 7: 24,275,913 Q441L probably damaging Het
Zfp976 A T 7: 42,614,186 Y76N probably damaging Het
Other mutations in Med18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Med18 APN 4 132459619 missense probably damaging 1.00
IGL02103:Med18 APN 4 132459666 missense probably damaging 0.98
IGL02983:Med18 APN 4 132459686 nonsense probably null
IGL03031:Med18 APN 4 132459613 missense possibly damaging 0.71
R0238:Med18 UTSW 4 132460026 missense probably damaging 0.96
R0238:Med18 UTSW 4 132460026 missense probably damaging 0.96
R1737:Med18 UTSW 4 132460109 missense probably damaging 1.00
R1894:Med18 UTSW 4 132459931 nonsense probably null
R2696:Med18 UTSW 4 132459970 missense probably damaging 1.00
R2900:Med18 UTSW 4 132459817 missense probably damaging 1.00
R3017:Med18 UTSW 4 132459817 missense probably damaging 1.00
R3019:Med18 UTSW 4 132459817 missense probably damaging 1.00
R3980:Med18 UTSW 4 132462940 missense probably benign 0.02
R4648:Med18 UTSW 4 132462963 missense possibly damaging 0.86
R5330:Med18 UTSW 4 132463066 intron probably benign
R6049:Med18 UTSW 4 132459713 missense probably benign
R6931:Med18 UTSW 4 132459883 missense probably damaging 0.99
R7556:Med18 UTSW 4 132459936 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CGAAACAGGTGTCCTTTGGC -3'
(R):5'- TCGCTGGTTTCATGACCCTAAATG -3'

Sequencing Primer
(F):5'- AAACTCATGGTCCATGCGG -3'
(R):5'- CCTAAATGAAATGAAAGCCGGGACTC -3'
Posted On 2018-07-24