Incidental Mutation 'R6694:1600015I10Rik'
ID 528489
Institutional Source Beutler Lab
Gene Symbol 1600015I10Rik
Ensembl Gene ENSMUSG00000029813
Gene Name RIKEN cDNA 1600015I10 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock # R6694 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 48929895-48933687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 48930546 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 160 (S160N)
Ref Sequence ENSEMBL: ENSMUSP00000031837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031837]
AlphaFold E9Q745
Predicted Effect probably benign
Transcript: ENSMUST00000031837
AA Change: S160N

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031837
Gene: ENSMUSG00000029813
AA Change: S160N

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 50 136 1.7e-25 PFAM
Pfam:Cu_amine_oxidN3 152 252 3.5e-16 PFAM
Pfam:Cu_amine_oxid 306 708 7.1e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158710
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,067,721 E120G probably damaging Het
Arap3 A C 18: 37,991,537 probably null Het
Arhgap10 A G 8: 77,411,063 F300L probably benign Het
Ccdc116 T C 16: 17,142,791 E54G probably benign Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Ctnnd1 T C 2: 84,624,505 probably benign Het
Ddx60 A G 8: 62,037,070 D1691G probably damaging Het
Dnah11 T C 12: 118,186,882 probably null Het
Exoc1 T A 5: 76,549,552 M392K probably damaging Het
Exoc3l G C 8: 105,290,490 R622G probably benign Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Kif20a A G 18: 34,625,526 E16G probably damaging Het
Kit T C 5: 75,640,757 V568A possibly damaging Het
Lhx4 T C 1: 155,704,710 S257G probably benign Het
Med18 C T 4: 132,459,982 V114I probably benign Het
Mrps30 C T 13: 118,386,961 V92M possibly damaging Het
Mtrr C T 13: 68,564,333 V645I probably benign Het
Nuak2 T G 1: 132,332,310 S609A probably damaging Het
Olfr1393 A T 11: 49,280,552 I135F probably benign Het
Plk4 T C 3: 40,801,828 V58A probably damaging Het
Polq T A 16: 37,015,173 F145L probably null Het
Rab11fip2 T C 19: 59,937,275 K170R probably damaging Het
Rapgef3 A G 15: 97,759,984 V246A probably benign Het
Rc3h2 A G 2: 37,400,543 S316P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 GCGGCGGC GCGGCGGCGACGGCGGC 7: 97,579,928 probably benign Het
Sae1 G T 7: 16,368,536 A171E probably damaging Het
Setd5 T A 6: 113,143,708 N959K probably benign Het
Siae T A 9: 37,616,823 Y31N probably damaging Het
Sit1 C T 4: 43,483,311 G51D probably damaging Het
Slc5a11 A G 7: 123,267,789 I436V possibly damaging Het
Tcfl5 A G 2: 180,622,654 S470P probably damaging Het
Timd2 A T 11: 46,670,952 C288* probably null Het
Timeless T G 10: 128,239,999 probably null Het
Ubxn8 G T 8: 33,621,544 Q274K possibly damaging Het
Usp29 A G 7: 6,962,277 E373G probably benign Het
Zap70 A G 1: 36,782,517 Y597C probably damaging Het
Zfp523 T G 17: 28,200,472 Y195D probably damaging Het
Zfp74 G A 7: 29,935,134 A383V probably damaging Het
Zfp93 A T 7: 24,275,913 Q441L probably damaging Het
Zfp976 A T 7: 42,614,186 Y76N probably damaging Het
Other mutations in 1600015I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:1600015I10Rik APN 6 48931040 missense probably damaging 1.00
IGL01347:1600015I10Rik APN 6 48932543 missense probably benign 0.02
IGL01751:1600015I10Rik APN 6 48930588 missense possibly damaging 0.79
IGL01915:1600015I10Rik APN 6 48931648 missense probably damaging 1.00
IGL02669:1600015I10Rik APN 6 48931473 missense probably damaging 1.00
IGL03033:1600015I10Rik APN 6 48932518 missense probably benign 0.00
IGL03242:1600015I10Rik APN 6 48932545 missense possibly damaging 0.68
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0448:1600015I10Rik UTSW 6 48933057 missense probably damaging 1.00
R1488:1600015I10Rik UTSW 6 48933447 missense possibly damaging 0.91
R1498:1600015I10Rik UTSW 6 48931371 missense probably benign 0.00
R1520:1600015I10Rik UTSW 6 48931297 nonsense probably null
R1922:1600015I10Rik UTSW 6 48931286 missense probably benign 0.00
R1992:1600015I10Rik UTSW 6 48930769 missense probably damaging 1.00
R1997:1600015I10Rik UTSW 6 48932429 missense probably damaging 0.98
R2021:1600015I10Rik UTSW 6 48931451 missense probably damaging 1.00
R3771:1600015I10Rik UTSW 6 48931196 missense probably damaging 1.00
R4208:1600015I10Rik UTSW 6 48931647 missense probably damaging 1.00
R4790:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5114:1600015I10Rik UTSW 6 48931358 missense probably benign 0.02
R5610:1600015I10Rik UTSW 6 48931019 missense probably benign 0.00
R5823:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5847:1600015I10Rik UTSW 6 48933478 missense probably damaging 1.00
R6233:1600015I10Rik UTSW 6 48930965 missense probably benign
R6357:1600015I10Rik UTSW 6 48930974 missense probably benign 0.00
R6733:1600015I10Rik UTSW 6 48930530 missense probably damaging 1.00
R6894:1600015I10Rik UTSW 6 48930662 missense probably damaging 1.00
R6898:1600015I10Rik UTSW 6 48931041 missense probably damaging 0.97
R6916:1600015I10Rik UTSW 6 48931053 missense probably benign 0.01
R7242:1600015I10Rik UTSW 6 48931128 missense probably damaging 1.00
R7762:1600015I10Rik UTSW 6 48932686 missense probably benign 0.07
R8257:1600015I10Rik UTSW 6 48932497 missense probably benign 0.04
R8391:1600015I10Rik UTSW 6 48932668 missense probably damaging 0.96
R8839:1600015I10Rik UTSW 6 48931040 missense probably damaging 1.00
R8863:1600015I10Rik UTSW 6 48930108 missense probably benign 0.00
R9266:1600015I10Rik UTSW 6 48930237 missense probably benign 0.00
R9274:1600015I10Rik UTSW 6 48930407 missense possibly damaging 0.94
R9380:1600015I10Rik UTSW 6 48933130 missense probably damaging 1.00
R9382:1600015I10Rik UTSW 6 48930364 missense probably benign 0.08
X0062:1600015I10Rik UTSW 6 48933132 missense possibly damaging 0.55
Z1176:1600015I10Rik UTSW 6 48932468 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ATAGAAATGCTGCTGCCCG -3'
(R):5'- CGTTGCAACATGAACCAGCTAC -3'

Sequencing Primer
(F):5'- AATGCTGCTGCCCGATAAG -3'
(R):5'- CTACAGCGCTGGTCAGATTTTG -3'
Posted On 2018-07-24