Incidental Mutation 'R6694:Usp29'
ID 528492
Institutional Source Beutler Lab
Gene Symbol Usp29
Ensembl Gene ENSMUSG00000051527
Gene Name ubiquitin specific peptidase 29
Synonyms Ocat
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6694 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 6730578-6967219 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6962277 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 373 (E373G)
Ref Sequence ENSEMBL: ENSMUSP00000143769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054055] [ENSMUST00000197117] [ENSMUST00000198068] [ENSMUST00000200535]
AlphaFold Q9ES63
Predicted Effect probably benign
Transcript: ENSMUST00000054055
AA Change: E373G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000062349
Gene: ENSMUSG00000051527
AA Change: E373G

DomainStartEndE-ValueType
Pfam:UCH_N 1 107 6.1e-37 PFAM
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
Pfam:UCH 288 823 6.1e-53 PFAM
Pfam:UCH_1 289 615 2.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197117
SMART Domains Protein: ENSMUSP00000143283
Gene: ENSMUSG00000051527

DomainStartEndE-ValueType
PDB:3U12|B 11 73 3e-7 PDB
low complexity region 82 95 N/A INTRINSIC
low complexity region 169 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198068
AA Change: E373G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143267
Gene: ENSMUSG00000051527
AA Change: E373G

DomainStartEndE-ValueType
PDB:3U12|B 11 123 3e-6 PDB
low complexity region 169 186 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
Pfam:UCH 295 830 7.9e-52 PFAM
Pfam:UCH_1 296 626 9.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200535
AA Change: E373G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143769
Gene: ENSMUSG00000051527
AA Change: E373G

DomainStartEndE-ValueType
Pfam:UCH_N 8 114 8.3e-34 PFAM
low complexity region 169 186 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
Pfam:UCH 295 830 2.8e-51 PFAM
Pfam:UCH_1 296 622 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204486
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,546 S160N probably benign Het
4930444G20Rik T C 10: 22,067,721 E120G probably damaging Het
Arap3 A C 18: 37,991,537 probably null Het
Arhgap10 A G 8: 77,411,063 F300L probably benign Het
Ccdc116 T C 16: 17,142,791 E54G probably benign Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Ctnnd1 T C 2: 84,624,505 probably benign Het
Ddx60 A G 8: 62,037,070 D1691G probably damaging Het
Dnah11 T C 12: 118,186,882 probably null Het
Exoc1 T A 5: 76,549,552 M392K probably damaging Het
Exoc3l G C 8: 105,290,490 R622G probably benign Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Kif20a A G 18: 34,625,526 E16G probably damaging Het
Kit T C 5: 75,640,757 V568A possibly damaging Het
Lhx4 T C 1: 155,704,710 S257G probably benign Het
Med18 C T 4: 132,459,982 V114I probably benign Het
Mrps30 C T 13: 118,386,961 V92M possibly damaging Het
Mtrr C T 13: 68,564,333 V645I probably benign Het
Nuak2 T G 1: 132,332,310 S609A probably damaging Het
Olfr1393 A T 11: 49,280,552 I135F probably benign Het
Plk4 T C 3: 40,801,828 V58A probably damaging Het
Polq T A 16: 37,015,173 F145L probably null Het
Rab11fip2 T C 19: 59,937,275 K170R probably damaging Het
Rapgef3 A G 15: 97,759,984 V246A probably benign Het
Rc3h2 A G 2: 37,400,543 S316P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 GCGGCGGC GCGGCGGCGACGGCGGC 7: 97,579,928 probably benign Het
Sae1 G T 7: 16,368,536 A171E probably damaging Het
Setd5 T A 6: 113,143,708 N959K probably benign Het
Siae T A 9: 37,616,823 Y31N probably damaging Het
Sit1 C T 4: 43,483,311 G51D probably damaging Het
Slc5a11 A G 7: 123,267,789 I436V possibly damaging Het
Tcfl5 A G 2: 180,622,654 S470P probably damaging Het
Timd2 A T 11: 46,670,952 C288* probably null Het
Timeless T G 10: 128,239,999 probably null Het
Ubxn8 G T 8: 33,621,544 Q274K possibly damaging Het
Zap70 A G 1: 36,782,517 Y597C probably damaging Het
Zfp523 T G 17: 28,200,472 Y195D probably damaging Het
Zfp74 G A 7: 29,935,134 A383V probably damaging Het
Zfp93 A T 7: 24,275,913 Q441L probably damaging Het
Zfp976 A T 7: 42,614,186 Y76N probably damaging Het
Other mutations in Usp29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Usp29 APN 7 6962282 missense probably benign 0.06
IGL01588:Usp29 APN 7 6962611 missense probably benign 0.33
IGL02032:Usp29 APN 7 6962018 missense probably benign 0.41
IGL02052:Usp29 APN 7 6962526 missense probably benign 0.06
IGL02331:Usp29 APN 7 6962156 missense probably benign 0.16
IGL02551:Usp29 APN 7 6963353 splice site probably null
IGL02573:Usp29 APN 7 6962618 splice site probably null
IGL02894:Usp29 APN 7 6961634 missense probably benign 0.00
R0029:Usp29 UTSW 7 6961581 missense probably damaging 0.99
R0142:Usp29 UTSW 7 6962335 missense probably benign 0.12
R0452:Usp29 UTSW 7 6963182 missense possibly damaging 0.82
R0680:Usp29 UTSW 7 6962885 missense possibly damaging 0.92
R1161:Usp29 UTSW 7 6961530 missense probably damaging 1.00
R2391:Usp29 UTSW 7 6963771 splice site probably null
R3104:Usp29 UTSW 7 6962053 nonsense probably null
R4119:Usp29 UTSW 7 6962806 missense probably benign 0.03
R4490:Usp29 UTSW 7 6961950 missense possibly damaging 0.68
R4598:Usp29 UTSW 7 6962480 missense probably benign 0.06
R4606:Usp29 UTSW 7 6963357 splice site probably null
R4670:Usp29 UTSW 7 6962915 missense possibly damaging 0.91
R4777:Usp29 UTSW 7 6962748 missense probably benign 0.07
R4783:Usp29 UTSW 7 6961391 missense probably damaging 1.00
R4785:Usp29 UTSW 7 6961391 missense probably damaging 1.00
R4896:Usp29 UTSW 7 6962159 missense probably benign 0.29
R4915:Usp29 UTSW 7 6961505 missense probably benign
R4944:Usp29 UTSW 7 6961928 missense possibly damaging 0.92
R5004:Usp29 UTSW 7 6962159 missense probably benign 0.29
R5171:Usp29 UTSW 7 6962075 missense probably damaging 0.99
R5268:Usp29 UTSW 7 6961584 missense probably damaging 0.98
R5572:Usp29 UTSW 7 6962192 missense probably benign 0.12
R5933:Usp29 UTSW 7 6961745 missense probably benign
R7389:Usp29 UTSW 7 6963458 missense possibly damaging 0.82
R7446:Usp29 UTSW 7 6961220 missense possibly damaging 0.93
R7447:Usp29 UTSW 7 6961220 missense possibly damaging 0.93
R7535:Usp29 UTSW 7 6961220 missense possibly damaging 0.93
R7537:Usp29 UTSW 7 6961220 missense possibly damaging 0.93
R8081:Usp29 UTSW 7 6963630 missense probably benign 0.02
R8233:Usp29 UTSW 7 6962407 missense probably benign 0.12
R8703:Usp29 UTSW 7 6961322 missense probably benign 0.32
R8725:Usp29 UTSW 7 6962918 missense probably damaging 0.98
R8727:Usp29 UTSW 7 6962918 missense probably damaging 0.98
R8844:Usp29 UTSW 7 6961892 missense probably benign 0.02
R9173:Usp29 UTSW 7 6961637 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGGGATTCCAACCTTTGCAAAG -3'
(R):5'- TTGATAGTAGCCTCACCACAGC -3'

Sequencing Primer
(F):5'- TTGCAAAGGACTTACTCACTCAAGG -3'
(R):5'- CTTCACAGATGATGGAGCTATGC -3'
Posted On 2018-07-24