Incidental Mutation 'R6694:Zfp74'
ID528495
Institutional Source Beutler Lab
Gene Symbol Zfp74
Ensembl Gene ENSMUSG00000059975
Gene Namezinc finger protein 74
SynonymsKRAB8, 2810054M15Rik, Zfp66
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6694 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location29930815-29954089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29935134 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 383 (A383V)
Ref Sequence ENSEMBL: ENSMUSP00000103840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032797] [ENSMUST00000108205] [ENSMUST00000108211] [ENSMUST00000108212]
Predicted Effect probably damaging
Transcript: ENSMUST00000032797
AA Change: A383V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032797
Gene: ENSMUSG00000059975
AA Change: A383V

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
ZnF_C2H2 179 201 1.84e-4 SMART
ZnF_C2H2 207 229 2.36e-2 SMART
ZnF_C2H2 235 257 1.5e-4 SMART
ZnF_C2H2 263 285 2.79e-4 SMART
ZnF_C2H2 291 313 3.49e-5 SMART
ZnF_C2H2 319 341 6.42e-4 SMART
ZnF_C2H2 347 369 5.59e-4 SMART
ZnF_C2H2 375 397 5.21e-4 SMART
ZnF_C2H2 403 425 3.63e-3 SMART
ZnF_C2H2 431 453 1.82e-3 SMART
ZnF_C2H2 459 481 1.58e-3 SMART
ZnF_C2H2 487 509 2.12e-4 SMART
ZnF_C2H2 515 537 1.82e-3 SMART
ZnF_C2H2 543 565 2.24e-3 SMART
ZnF_C2H2 571 593 8.02e-5 SMART
ZnF_C2H2 599 621 1.04e-3 SMART
ZnF_C2H2 627 649 1.04e-3 SMART
ZnF_C2H2 655 677 9.88e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108205
AA Change: A383V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103840
Gene: ENSMUSG00000059975
AA Change: A383V

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
ZnF_C2H2 179 201 1.84e-4 SMART
ZnF_C2H2 207 229 2.36e-2 SMART
ZnF_C2H2 235 257 1.5e-4 SMART
ZnF_C2H2 263 285 2.79e-4 SMART
ZnF_C2H2 291 313 3.49e-5 SMART
ZnF_C2H2 319 341 6.42e-4 SMART
ZnF_C2H2 347 369 5.59e-4 SMART
ZnF_C2H2 375 397 5.21e-4 SMART
ZnF_C2H2 403 425 3.63e-3 SMART
ZnF_C2H2 431 453 1.82e-3 SMART
ZnF_C2H2 459 481 1.58e-3 SMART
ZnF_C2H2 487 509 2.12e-4 SMART
ZnF_C2H2 515 537 1.82e-3 SMART
ZnF_C2H2 543 565 2.24e-3 SMART
ZnF_C2H2 571 593 8.02e-5 SMART
ZnF_C2H2 599 621 1.04e-3 SMART
ZnF_C2H2 627 649 1.04e-3 SMART
ZnF_C2H2 655 677 9.88e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108211
SMART Domains Protein: ENSMUSP00000103846
Gene: ENSMUSG00000059975

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108212
SMART Domains Protein: ENSMUSP00000103847
Gene: ENSMUSG00000059975

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208490
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,546 S160N probably benign Het
4930444G20Rik T C 10: 22,067,721 E120G probably damaging Het
Arap3 A C 18: 37,991,537 probably null Het
Arhgap10 A G 8: 77,411,063 F300L probably benign Het
Ccdc116 T C 16: 17,142,791 E54G probably benign Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Ctnnd1 T C 2: 84,624,505 probably benign Het
Ddx60 A G 8: 62,037,070 D1691G probably damaging Het
Dnah11 T C 12: 118,186,882 probably null Het
Exoc1 T A 5: 76,549,552 M392K probably damaging Het
Exoc3l G C 8: 105,290,490 R622G probably benign Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Kif20a A G 18: 34,625,526 E16G probably damaging Het
Kit T C 5: 75,640,757 V568A possibly damaging Het
Lhx4 T C 1: 155,704,710 S257G probably benign Het
Med18 C T 4: 132,459,982 V114I probably benign Het
Mrps30 C T 13: 118,386,961 V92M possibly damaging Het
Mtrr C T 13: 68,564,333 V645I probably benign Het
Nuak2 T G 1: 132,332,310 S609A probably damaging Het
Olfr1393 A T 11: 49,280,552 I135F probably benign Het
Plk4 T C 3: 40,801,828 V58A probably damaging Het
Polq T A 16: 37,015,173 F145L probably null Het
Rab11fip2 T C 19: 59,937,275 K170R probably damaging Het
Rapgef3 A G 15: 97,759,984 V246A probably benign Het
Rc3h2 A G 2: 37,400,543 S316P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 GCGGCGGC GCGGCGGCGACGGCGGC 7: 97,579,928 probably benign Het
Sae1 G T 7: 16,368,536 A171E probably damaging Het
Setd5 T A 6: 113,143,708 N959K probably benign Het
Siae T A 9: 37,616,823 Y31N probably damaging Het
Sit1 C T 4: 43,483,311 G51D probably damaging Het
Slc5a11 A G 7: 123,267,789 I436V possibly damaging Het
Tcfl5 A G 2: 180,622,654 S470P probably damaging Het
Timd2 A T 11: 46,670,952 C288* probably null Het
Timeless T G 10: 128,239,999 probably null Het
Ubxn8 G T 8: 33,621,544 Q274K possibly damaging Het
Usp29 A G 7: 6,962,277 E373G probably benign Het
Zap70 A G 1: 36,782,517 Y597C probably damaging Het
Zfp523 T G 17: 28,200,472 Y195D probably damaging Het
Zfp93 A T 7: 24,275,913 Q441L probably damaging Het
Zfp976 A T 7: 42,614,186 Y76N probably damaging Het
Other mutations in Zfp74
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0355:Zfp74 UTSW 7 29954041 start gained probably benign
R0387:Zfp74 UTSW 7 29934754 missense probably benign 0.05
R0948:Zfp74 UTSW 7 29935937 critical splice donor site probably null
R1757:Zfp74 UTSW 7 29935061 missense probably benign 0.01
R1813:Zfp74 UTSW 7 29935144 missense probably damaging 1.00
R1893:Zfp74 UTSW 7 29936045 critical splice acceptor site probably null
R1896:Zfp74 UTSW 7 29935144 missense probably damaging 1.00
R1958:Zfp74 UTSW 7 29935711 missense probably benign 0.08
R2092:Zfp74 UTSW 7 29953924 start gained probably benign
R2111:Zfp74 UTSW 7 29935018 nonsense probably null
R4894:Zfp74 UTSW 7 29936045 critical splice acceptor site probably benign
R5121:Zfp74 UTSW 7 29932507 intron probably null
R5123:Zfp74 UTSW 7 29934733 missense probably damaging 1.00
R5129:Zfp74 UTSW 7 29932455 missense probably benign 0.00
R5213:Zfp74 UTSW 7 29935243 missense probably damaging 1.00
R5460:Zfp74 UTSW 7 29935891 missense probably benign 0.04
R5519:Zfp74 UTSW 7 29935134 missense probably damaging 0.99
R5589:Zfp74 UTSW 7 29934565 missense probably damaging 1.00
R6287:Zfp74 UTSW 7 29935776 missense probably benign
R6330:Zfp74 UTSW 7 29937987 missense probably damaging 1.00
R6370:Zfp74 UTSW 7 29932410 missense probably damaging 0.96
R6407:Zfp74 UTSW 7 29935623 missense probably damaging 1.00
R6791:Zfp74 UTSW 7 29934435 missense probably benign 0.02
R7144:Zfp74 UTSW 7 29935165 missense probably damaging 0.98
R7662:Zfp74 UTSW 7 29953853 critical splice donor site probably null
R7667:Zfp74 UTSW 7 29935183 missense probably damaging 1.00
R7898:Zfp74 UTSW 7 29935955 nonsense probably null
R7981:Zfp74 UTSW 7 29935955 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCCCGTATGAACTTTCTGATGG -3'
(R):5'- TCACACTGGGGAGAAGCCTTA -3'

Sequencing Primer
(F):5'- GCCTGACAAGGTTTGACATC -3'
(R):5'- GAGAAGCCTTACGCGTGCAAC -3'
Posted On2018-07-24