Mutagenetix > Incidental Mutations

Incidental Mutation 'R6694:Siae'

528504

Institutional Source

Beutler Lab

Gene Symbol

Siae

Ensembl Gene

ENSMUSG00000001942

Gene Name

sialic acid acetylesterase

Synonyms

LSE, clone 165, Ysg2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R6694 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37555698-37649655 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 37616823 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 31 (Y31N)

Ref Sequence

ENSEMBL: ENSMUSP00000149505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002007] [ENSMUST00000002013] [ENSMUST00000213126] [ENSMUST00000214786] [ENSMUST00000215474] [ENSMUST00000215829]

Predicted Effect

probably benign
Transcript: ENSMUST00000002007

SMART Domains

Protein: ENSMUSP00000002007
Gene: ENSMUSG00000001942

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:DUF303	118	420	1.1e-77	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000002013

SMART Domains

Protein: ENSMUSP00000002013
Gene: ENSMUSG00000001948

Domain	Start	End	E-Value	Type
RIIa	14	51	7.04e-15	SMART
low complexity region	75	86	N/A	INTRINSIC
IQ	111	133	7.4e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213126

Predicted Effect

probably benign
Transcript: ENSMUST00000214786

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215336

Predicted Effect

probably damaging
Transcript: ENSMUST00000215474
AA Change: Y31N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215678

Predicted Effect

probably benign
Transcript: ENSMUST00000215829

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217567

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.7%

Validation Efficiency

95% (41/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which removes 9-O-acetylation modifications from sialic acids. Mutations in this gene are associated with susceptibility to autoimmune disease 6. Multiple transcript variants encoding different isoforms, found either in the cytosol or in the lysosome, have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit normal marginal zone B cell and memory phenotype T cell numbers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	G	A	6: 48,930,546	S160N	probably benign	Het
4930444G20Rik	T	C	10: 22,067,721	E120G	probably damaging	Het
Arap3	A	C	18: 37,991,537		probably null	Het
Arhgap10	A	G	8: 77,411,063	F300L	probably benign	Het
Ccdc116	T	C	16: 17,142,791	E54G	probably benign	Het
Cd53	T	A	3: 106,767,386	I122F	probably benign	Het
Ctnnd1	T	C	2: 84,624,505		probably benign	Het
Ddx60	A	G	8: 62,037,070	D1691G	probably damaging	Het
Dnah11	T	C	12: 118,186,882		probably null	Het
Exoc1	T	A	5: 76,549,552	M392K	probably damaging	Het
Exoc3l	G	C	8: 105,290,490	R622G	probably benign	Het
Grid2	C	G	6: 63,931,047	R224G	possibly damaging	Het
Kif20a	A	G	18: 34,625,526	E16G	probably damaging	Het
Kit	T	C	5: 75,640,757	V568A	possibly damaging	Het
Lhx4	T	C	1: 155,704,710	S257G	probably benign	Het
Med18	C	T	4: 132,459,982	V114I	probably benign	Het
Mrps30	C	T	13: 118,386,961	V92M	possibly damaging	Het
Mtrr	C	T	13: 68,564,333	V645I	probably benign	Het
Nuak2	T	G	1: 132,332,310	S609A	probably damaging	Het
Olfr1393	A	T	11: 49,280,552	I135F	probably benign	Het
Plk4	T	C	3: 40,801,828	V58A	probably damaging	Het
Polq	T	A	16: 37,015,173	F145L	probably null	Het
Rab11fip2	T	C	19: 59,937,275	K170R	probably damaging	Het
Rapgef3	A	G	15: 97,759,984	V246A	probably benign	Het
Rc3h2	A	G	2: 37,400,543	S316P	probably damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Homo
Rsf1	GCGGCGGC	GCGGCGGCGACGGCGGC	7: 97,579,928		probably benign	Het
Sae1	G	T	7: 16,368,536	A171E	probably damaging	Het
Setd5	T	A	6: 113,143,708	N959K	probably benign	Het
Sit1	C	T	4: 43,483,311	G51D	probably damaging	Het
Slc5a11	A	G	7: 123,267,789	I436V	possibly damaging	Het
Tcfl5	A	G	2: 180,622,654	S470P	probably damaging	Het
Timd2	A	T	11: 46,670,952	C288*	probably null	Het
Timeless	T	G	10: 128,239,999		probably null	Het
Ubxn8	G	T	8: 33,621,544	Q274K	possibly damaging	Het
Usp29	A	G	7: 6,962,277	E373G	probably benign	Het
Zap70	A	G	1: 36,782,517	Y597C	probably damaging	Het
Zfp523	T	G	17: 28,200,472	Y195D	probably damaging	Het
Zfp74	G	A	7: 29,935,134	A383V	probably damaging	Het
Zfp93	A	T	7: 24,275,913	Q441L	probably damaging	Het
Zfp976	A	T	7: 42,614,186	Y76N	probably damaging	Het

Other mutations in Siae

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01734:Siae	APN	9	37631486	missense	probably damaging	0.98
IGL02696:Siae	APN	9	37631384	missense	probably damaging	1.00
BB009:Siae	UTSW	9	37633684	missense	probably benign	0.12
BB019:Siae	UTSW	9	37633684	missense	probably benign	0.12
R0531:Siae	UTSW	9	37627794	missense	probably benign	0.04
R1138:Siae	UTSW	9	37642692	missense	probably damaging	1.00
R1748:Siae	UTSW	9	37631606	critical splice donor site	probably null
R2175:Siae	UTSW	9	37627796	missense	probably damaging	1.00
R4301:Siae	UTSW	9	37633713	missense	possibly damaging	0.51
R4887:Siae	UTSW	9	37627800	missense	possibly damaging	0.93
R4989:Siae	UTSW	9	37646520	missense	possibly damaging	0.79
R5133:Siae	UTSW	9	37646520	missense	possibly damaging	0.79
R5134:Siae	UTSW	9	37646520	missense	possibly damaging	0.79
R5151:Siae	UTSW	9	37631573	missense	probably benign	0.02
R5242:Siae	UTSW	9	37644852	missense	probably damaging	1.00
R5459:Siae	UTSW	9	37616823	missense	probably damaging	1.00
R5571:Siae	UTSW	9	37616923	missense	probably benign	0.01
R6335:Siae	UTSW	9	37632981	missense	probably benign	0.03
R6552:Siae	UTSW	9	37646400	missense	possibly damaging	0.57
R6692:Siae	UTSW	9	37642799	critical splice donor site	probably null
R7183:Siae	UTSW	9	37616946	missense	possibly damaging	0.77
R7266:Siae	UTSW	9	37623013	missense	probably damaging	0.98
R7697:Siae	UTSW	9	37633654	missense	probably damaging	1.00
R7821:Siae	UTSW	9	37644900	missense	probably damaging	1.00
R7932:Siae	UTSW	9	37633684	missense	probably benign	0.12
R8312:Siae	UTSW	9	37646297	missense
R8377:Siae	UTSW	9	37631605	critical splice donor site	probably null
R8868:Siae	UTSW	9	37616836	missense	probably damaging	1.00
Z1176:Siae	UTSW	9	37631469	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AATGGTCATGTTCTGCTGTGATAC -3'
(R):5'- TCATTTTCAGATAATCCAGCAGGTG -3'

Sequencing Primer
(F):5'- TTTAATCTGGAGCAACTGGACCCG -3'
(R):5'- TGGCAGAAGAGGACAATAACTGAAC -3'

Posted On

2018-07-24