Mutagenetix > Incidental Mutation

Incidental Mutation 'R6694:Timeless'

528506

Institutional Source

Beutler Lab

Gene Symbol

Timeless

Ensembl Gene

ENSMUSG00000039994

Gene Name

timeless circadian clock 1

Synonyms

tim

MMRRC Submission

044812-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6694 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128232065-128252941 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to G at 128239999 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000100879 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055539] [ENSMUST00000105242] [ENSMUST00000105243] [ENSMUST00000105244] [ENSMUST00000105245] [ENSMUST00000125289]

AlphaFold

Q9R1X4

Predicted Effect

probably null
Transcript: ENSMUST00000055539

SMART Domains

Protein: ENSMUSP00000058021
Gene: ENSMUSG00000039994

Domain	Start	End	E-Value	Type
Pfam:TIMELESS	21	285	2.2e-102	PFAM
low complexity region	381	395	N/A	INTRINSIC
low complexity region	528	537	N/A	INTRINSIC
low complexity region	653	682	N/A	INTRINSIC
Pfam:TIMELESS_C	722	1197	1.9e-186	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000105242

SMART Domains

Protein: ENSMUSP00000100876
Gene: ENSMUSG00000039994

Domain	Start	End	E-Value	Type
Pfam:TIMELESS	21	285	2.1e-102	PFAM
low complexity region	381	395	N/A	INTRINSIC
low complexity region	528	537	N/A	INTRINSIC
low complexity region	653	682	N/A	INTRINSIC
Pfam:TIMELESS_C	722	1196	4.4e-187	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000105243

SMART Domains

Protein: ENSMUSP00000100877
Gene: ENSMUSG00000039994

Domain	Start	End	E-Value	Type
Pfam:TIMELESS	21	285	7.8e-104	PFAM
low complexity region	381	395	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000105244

SMART Domains

Protein: ENSMUSP00000100878
Gene: ENSMUSG00000039994

Domain	Start	End	E-Value	Type
Pfam:TIMELESS	21	285	2.3e-103	PFAM
low complexity region	381	395	N/A	INTRINSIC
low complexity region	528	537	N/A	INTRINSIC
low complexity region	653	682	N/A	INTRINSIC
Pfam:TIMELESS_C	722	1196	5e-187	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000105245

SMART Domains

Protein: ENSMUSP00000100879
Gene: ENSMUSG00000039994

Domain	Start	End	E-Value	Type
Pfam:TIMELESS	24	284	1.1e-81	PFAM
low complexity region	381	395	N/A	INTRINSIC
low complexity region	528	537	N/A	INTRINSIC
low complexity region	653	682	N/A	INTRINSIC
Pfam:TIMELESS_C	722	1197	1.9e-186	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125289

SMART Domains

Protein: ENSMUSP00000132079
Gene: ENSMUSG00000039994

Domain	Start	End	E-Value	Type
Pfam:TIMELESS	1	123	3.6e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135376

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135538

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142149

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145710

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146945

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.7%

Validation Efficiency

95% (41/43)

MGI Phenotype

FUNCTION: The protein encoded by this gene is highly conserved and is involved in cell survival after damage or stress, increase in DNA polymerase epsilon activity, maintenance of telomere length, and epithelial cell morphogenesis. The encoded protein also plays a role in the circadian rhythm autoregulatory loop, interacting with the PERIOD genes (PER1, PER2, and PER3) and others to downregulate activation of PER1 by CLOCK/ARNTL. Changes in this gene or its expression may promote prostate cancer, lung cancer, breast cancer, and mental disorders. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit early embryonic lethality at aprroximately the time of implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	G	A	6: 48,930,546	S160N	probably benign	Het
4930444G20Rik	T	C	10: 22,067,721	E120G	probably damaging	Het
Arap3	A	C	18: 37,991,537		probably null	Het
Arhgap10	A	G	8: 77,411,063	F300L	probably benign	Het
Ccdc116	T	C	16: 17,142,791	E54G	probably benign	Het
Cd53	T	A	3: 106,767,386	I122F	probably benign	Het
Ctnnd1	T	C	2: 84,624,505		probably benign	Het
Ddx60	A	G	8: 62,037,070	D1691G	probably damaging	Het
Dnah11	T	C	12: 118,186,882		probably null	Het
Exoc1	T	A	5: 76,549,552	M392K	probably damaging	Het
Exoc3l	G	C	8: 105,290,490	R622G	probably benign	Het
Grid2	C	G	6: 63,931,047	R224G	possibly damaging	Het
Kif20a	A	G	18: 34,625,526	E16G	probably damaging	Het
Kit	T	C	5: 75,640,757	V568A	possibly damaging	Het
Lhx4	T	C	1: 155,704,710	S257G	probably benign	Het
Med18	C	T	4: 132,459,982	V114I	probably benign	Het
Mrps30	C	T	13: 118,386,961	V92M	possibly damaging	Het
Mtrr	C	T	13: 68,564,333	V645I	probably benign	Het
Nuak2	T	G	1: 132,332,310	S609A	probably damaging	Het
Olfr1393	A	T	11: 49,280,552	I135F	probably benign	Het
Plk4	T	C	3: 40,801,828	V58A	probably damaging	Het
Polq	T	A	16: 37,015,173	F145L	probably null	Het
Rab11fip2	T	C	19: 59,937,275	K170R	probably damaging	Het
Rapgef3	A	G	15: 97,759,984	V246A	probably benign	Het
Rc3h2	A	G	2: 37,400,543	S316P	probably damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Homo
Rsf1	GCGGCGGC	GCGGCGGCGACGGCGGC	7: 97,579,928		probably benign	Het
Sae1	G	T	7: 16,368,536	A171E	probably damaging	Het
Setd5	T	A	6: 113,143,708	N959K	probably benign	Het
Siae	T	A	9: 37,616,823	Y31N	probably damaging	Het
Sit1	C	T	4: 43,483,311	G51D	probably damaging	Het
Slc5a11	A	G	7: 123,267,789	I436V	possibly damaging	Het
Tcfl5	A	G	2: 180,622,654	S470P	probably damaging	Het
Timd2	A	T	11: 46,670,952	C288*	probably null	Het
Ubxn8	G	T	8: 33,621,544	Q274K	possibly damaging	Het
Usp29	A	G	7: 6,962,277	E373G	probably benign	Het
Zap70	A	G	1: 36,782,517	Y597C	probably damaging	Het
Zfp523	T	G	17: 28,200,472	Y195D	probably damaging	Het
Zfp74	G	A	7: 29,935,134	A383V	probably damaging	Het
Zfp93	A	T	7: 24,275,913	Q441L	probably damaging	Het
Zfp976	A	T	7: 42,614,186	Y76N	probably damaging	Het

Other mutations in Timeless

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Timeless	APN	10	128241708	missense	probably damaging	1.00
IGL02157:Timeless	APN	10	128242386	missense	probably benign	0.01
IGL02300:Timeless	APN	10	128244807	missense	probably benign	0.00
IGL02587:Timeless	APN	10	128239916	missense	probably damaging	0.99
IGL02588:Timeless	APN	10	128243334	missense	probably damaging	1.00
IGL02892:Timeless	APN	10	128244251	missense	probably damaging	1.00
IGL02930:Timeless	APN	10	128247191	missense	probably benign	0.00
IGL02986:Timeless	APN	10	128249760	missense	possibly damaging	0.82
IGL03345:Timeless	APN	10	128247586	missense	probably benign	0.04
IGL03393:Timeless	APN	10	128252055	missense	probably damaging	1.00
R0388:Timeless	UTSW	10	128241425	splice site	probably null
R0607:Timeless	UTSW	10	128246334	missense	probably benign
R0638:Timeless	UTSW	10	128244673	nonsense	probably null
R0734:Timeless	UTSW	10	128250060	missense	probably damaging	1.00
R1346:Timeless	UTSW	10	128242365	missense	possibly damaging	0.83
R1625:Timeless	UTSW	10	128240624	missense	probably damaging	0.99
R1771:Timeless	UTSW	10	128247608	missense	probably benign	0.11
R1860:Timeless	UTSW	10	128246114	missense	probably benign	0.00
R1920:Timeless	UTSW	10	128241714	missense	probably damaging	1.00
R1988:Timeless	UTSW	10	128244187	missense	probably damaging	0.98
R2981:Timeless	UTSW	10	128248458	missense	probably benign	0.34
R4359:Timeless	UTSW	10	128247342	missense	probably benign	0.00
R4647:Timeless	UTSW	10	128239956	missense	possibly damaging	0.80
R4753:Timeless	UTSW	10	128240020	utr 5 prime	probably benign
R4868:Timeless	UTSW	10	128247361	missense	probably benign
R4901:Timeless	UTSW	10	128250762	missense	probably damaging	1.00
R4956:Timeless	UTSW	10	128241651	missense	probably damaging	1.00
R5341:Timeless	UTSW	10	128247178	missense	possibly damaging	0.81
R5439:Timeless	UTSW	10	128241735	missense	probably damaging	1.00
R5585:Timeless	UTSW	10	128240243	missense	probably damaging	0.97
R5842:Timeless	UTSW	10	128247459	critical splice donor site	probably null
R5843:Timeless	UTSW	10	128244244	splice site	probably null
R6005:Timeless	UTSW	10	128244200	missense	probably damaging	0.99
R6271:Timeless	UTSW	10	128250724	missense	probably damaging	1.00
R6558:Timeless	UTSW	10	128249563	missense	probably benign	0.01
R6738:Timeless	UTSW	10	128240635	missense	probably damaging	1.00
R6760:Timeless	UTSW	10	128246117	missense	probably benign	0.38
R7213:Timeless	UTSW	10	128243289	missense	probably benign
R7248:Timeless	UTSW	10	128252001	missense	probably benign
R7345:Timeless	UTSW	10	128249754	missense	probably damaging	1.00
R7463:Timeless	UTSW	10	128250426	missense	probably benign	0.00
R7513:Timeless	UTSW	10	128249530	missense	probably damaging	0.99
R7574:Timeless	UTSW	10	128244669	missense	probably damaging	1.00
R8220:Timeless	UTSW	10	128246396	missense	probably damaging	0.98
R8418:Timeless	UTSW	10	128250736	missense	probably benign	0.02
R8742:Timeless	UTSW	10	128247238	missense	probably benign	0.00
R8765:Timeless	UTSW	10	128244543	critical splice donor site	probably null
R9508:Timeless	UTSW	10	128240227	missense	probably benign	0.01
X0028:Timeless	UTSW	10	128250325	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTAAGGGTCCTGAGTGCAAG -3'
(R):5'- CCTCAGGTATCGGATCAAATCC -3'

Sequencing Primer
(F):5'- TCCTGAGTGCAAGCCCAG -3'
(R):5'- CTCACCAGACCAATTTGG -3'

Posted On

2018-07-24