Incidental Mutation 'R6694:Timd2'
ID 528507
Institutional Source Beutler Lab
Gene Symbol Timd2
Ensembl Gene ENSMUSG00000040413
Gene Name T cell immunoglobulin and mucin domain containing 2
Synonyms TIM-2, Tim2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R6694 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 46668960-46707061 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 46670952 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 288 (C288*)
Ref Sequence ENSEMBL: ENSMUSP00000131540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055102] [ENSMUST00000109225] [ENSMUST00000169584]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000055102
AA Change: C288*
SMART Domains Protein: ENSMUSP00000060891
Gene: ENSMUSG00000040413
AA Change: C288*

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109225
AA Change: C288*
SMART Domains Protein: ENSMUSP00000104848
Gene: ENSMUSG00000040413
AA Change: C288*

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169584
AA Change: C288*
SMART Domains Protein: ENSMUSP00000131540
Gene: ENSMUSG00000040413
AA Change: C288*

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an exacerbated inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,546 S160N probably benign Het
4930444G20Rik T C 10: 22,067,721 E120G probably damaging Het
Arap3 A C 18: 37,991,537 probably null Het
Arhgap10 A G 8: 77,411,063 F300L probably benign Het
Ccdc116 T C 16: 17,142,791 E54G probably benign Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Ctnnd1 T C 2: 84,624,505 probably benign Het
Ddx60 A G 8: 62,037,070 D1691G probably damaging Het
Dnah11 T C 12: 118,186,882 probably null Het
Exoc1 T A 5: 76,549,552 M392K probably damaging Het
Exoc3l G C 8: 105,290,490 R622G probably benign Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Kif20a A G 18: 34,625,526 E16G probably damaging Het
Kit T C 5: 75,640,757 V568A possibly damaging Het
Lhx4 T C 1: 155,704,710 S257G probably benign Het
Med18 C T 4: 132,459,982 V114I probably benign Het
Mrps30 C T 13: 118,386,961 V92M possibly damaging Het
Mtrr C T 13: 68,564,333 V645I probably benign Het
Nuak2 T G 1: 132,332,310 S609A probably damaging Het
Olfr1393 A T 11: 49,280,552 I135F probably benign Het
Plk4 T C 3: 40,801,828 V58A probably damaging Het
Polq T A 16: 37,015,173 F145L probably null Het
Rab11fip2 T C 19: 59,937,275 K170R probably damaging Het
Rapgef3 A G 15: 97,759,984 V246A probably benign Het
Rc3h2 A G 2: 37,400,543 S316P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 GCGGCGGC GCGGCGGCGACGGCGGC 7: 97,579,928 probably benign Het
Sae1 G T 7: 16,368,536 A171E probably damaging Het
Setd5 T A 6: 113,143,708 N959K probably benign Het
Siae T A 9: 37,616,823 Y31N probably damaging Het
Sit1 C T 4: 43,483,311 G51D probably damaging Het
Slc5a11 A G 7: 123,267,789 I436V possibly damaging Het
Tcfl5 A G 2: 180,622,654 S470P probably damaging Het
Timeless T G 10: 128,239,999 probably null Het
Ubxn8 G T 8: 33,621,544 Q274K possibly damaging Het
Usp29 A G 7: 6,962,277 E373G probably benign Het
Zap70 A G 1: 36,782,517 Y597C probably damaging Het
Zfp523 T G 17: 28,200,472 Y195D probably damaging Het
Zfp74 G A 7: 29,935,134 A383V probably damaging Het
Zfp93 A T 7: 24,275,913 Q441L probably damaging Het
Zfp976 A T 7: 42,614,186 Y76N probably damaging Het
Other mutations in Timd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Timd2 APN 11 46676343 missense probably benign 0.15
IGL01289:Timd2 APN 11 46679672 missense probably benign 0.00
IGL02066:Timd2 APN 11 46678223 missense probably damaging 0.98
IGL02439:Timd2 APN 11 46678236 splice site probably benign
R2217:Timd2 UTSW 11 46687017 missense probably damaging 1.00
R2218:Timd2 UTSW 11 46687017 missense probably damaging 1.00
R2240:Timd2 UTSW 11 46678216 missense probably benign 0.01
R3621:Timd2 UTSW 11 46678213 missense probably benign 0.00
R3876:Timd2 UTSW 11 46671020 critical splice acceptor site probably null
R4173:Timd2 UTSW 11 46670960 missense probably benign 0.00
R4793:Timd2 UTSW 11 46687181 missense probably damaging 1.00
R4799:Timd2 UTSW 11 46677267 nonsense probably null
R4963:Timd2 UTSW 11 46682790 missense possibly damaging 0.66
R5314:Timd2 UTSW 11 46677260 missense probably benign 0.09
R5798:Timd2 UTSW 11 46677237 missense probably benign 0.06
R6074:Timd2 UTSW 11 46687172 missense possibly damaging 0.88
R6090:Timd2 UTSW 11 46687236 missense probably benign 0.11
R7817:Timd2 UTSW 11 46670954 missense probably benign 0.00
R8379:Timd2 UTSW 11 46677200 splice site probably null
R9321:Timd2 UTSW 11 46687089 missense probably benign 0.00
R9483:Timd2 UTSW 11 46687062 missense probably damaging 1.00
Z1177:Timd2 UTSW 11 46679679 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GAGTGTACACAGTAGAGGGTTACCC -3'
(R):5'- AATACTGAGGGCCTGTGTGG -3'

Sequencing Primer
(F):5'- CTCTCCACTACAGCTGGAAG -3'
(R):5'- AGGGCCTGTGTGGAACTATTCAC -3'
Posted On 2018-07-24