Incidental Mutation 'R6694:Olfr1393'
ID 528508
Institutional Source Beutler Lab
Gene Symbol Olfr1393
Ensembl Gene ENSMUSG00000059864
Gene Name olfactory receptor 1393
Synonyms MOR256-67_i, GA_x6K02T2QP88-6154577-6153642, MOR256-24
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R6694 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 49278304-49282769 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 49280552 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 135 (I135F)
Ref Sequence ENSEMBL: ENSMUSP00000149358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078932] [ENSMUST00000213323] [ENSMUST00000214170] [ENSMUST00000214598] [ENSMUST00000215861] [ENSMUST00000217275]
AlphaFold Q8VFA7
Predicted Effect probably benign
Transcript: ENSMUST00000078932
AA Change: I135F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000077962
Gene: ENSMUSG00000059864
AA Change: I135F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 230 3e-6 PFAM
Pfam:7tm_1 41 289 5.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213323
AA Change: I135F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213684
Predicted Effect probably benign
Transcript: ENSMUST00000214170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214516
Predicted Effect probably benign
Transcript: ENSMUST00000214598
Predicted Effect probably benign
Transcript: ENSMUST00000215861
Predicted Effect probably benign
Transcript: ENSMUST00000217275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217626
Meta Mutation Damage Score 0.2881 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,546 S160N probably benign Het
4930444G20Rik T C 10: 22,067,721 E120G probably damaging Het
Arap3 A C 18: 37,991,537 probably null Het
Arhgap10 A G 8: 77,411,063 F300L probably benign Het
Ccdc116 T C 16: 17,142,791 E54G probably benign Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Ctnnd1 T C 2: 84,624,505 probably benign Het
Ddx60 A G 8: 62,037,070 D1691G probably damaging Het
Dnah11 T C 12: 118,186,882 probably null Het
Exoc1 T A 5: 76,549,552 M392K probably damaging Het
Exoc3l G C 8: 105,290,490 R622G probably benign Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Kif20a A G 18: 34,625,526 E16G probably damaging Het
Kit T C 5: 75,640,757 V568A possibly damaging Het
Lhx4 T C 1: 155,704,710 S257G probably benign Het
Med18 C T 4: 132,459,982 V114I probably benign Het
Mrps30 C T 13: 118,386,961 V92M possibly damaging Het
Mtrr C T 13: 68,564,333 V645I probably benign Het
Nuak2 T G 1: 132,332,310 S609A probably damaging Het
Plk4 T C 3: 40,801,828 V58A probably damaging Het
Polq T A 16: 37,015,173 F145L probably null Het
Rab11fip2 T C 19: 59,937,275 K170R probably damaging Het
Rapgef3 A G 15: 97,759,984 V246A probably benign Het
Rc3h2 A G 2: 37,400,543 S316P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 GCGGCGGC GCGGCGGCGACGGCGGC 7: 97,579,928 probably benign Het
Sae1 G T 7: 16,368,536 A171E probably damaging Het
Setd5 T A 6: 113,143,708 N959K probably benign Het
Siae T A 9: 37,616,823 Y31N probably damaging Het
Sit1 C T 4: 43,483,311 G51D probably damaging Het
Slc5a11 A G 7: 123,267,789 I436V possibly damaging Het
Tcfl5 A G 2: 180,622,654 S470P probably damaging Het
Timd2 A T 11: 46,670,952 C288* probably null Het
Timeless T G 10: 128,239,999 probably null Het
Ubxn8 G T 8: 33,621,544 Q274K possibly damaging Het
Usp29 A G 7: 6,962,277 E373G probably benign Het
Zap70 A G 1: 36,782,517 Y597C probably damaging Het
Zfp523 T G 17: 28,200,472 Y195D probably damaging Het
Zfp74 G A 7: 29,935,134 A383V probably damaging Het
Zfp93 A T 7: 24,275,913 Q441L probably damaging Het
Zfp976 A T 7: 42,614,186 Y76N probably damaging Het
Other mutations in Olfr1393
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Olfr1393 APN 11 49280487 missense possibly damaging 0.94
IGL02291:Olfr1393 APN 11 49280985 missense probably damaging 1.00
IGL03127:Olfr1393 APN 11 49280772 missense possibly damaging 0.88
R0580:Olfr1393 UTSW 11 49280622 missense probably damaging 0.97
R1985:Olfr1393 UTSW 11 49280283 missense probably damaging 1.00
R4812:Olfr1393 UTSW 11 49280457 missense possibly damaging 0.94
R5190:Olfr1393 UTSW 11 49280382 missense probably damaging 0.99
R6911:Olfr1393 UTSW 11 49280807 missense probably benign 0.22
R7012:Olfr1393 UTSW 11 49280996 missense probably benign 0.07
R7159:Olfr1393 UTSW 11 49280358 missense probably damaging 1.00
R7541:Olfr1393 UTSW 11 49280333 missense probably damaging 1.00
R7759:Olfr1393 UTSW 11 49280636 missense probably benign 0.00
R8767:Olfr1393 UTSW 11 49280400 missense possibly damaging 0.87
R9069:Olfr1393 UTSW 11 49280420 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAACAGACCTTCGACTGCAC -3'
(R):5'- GCCACAAACATCTTGGCCTC -3'

Sequencing Primer
(F):5'- GGACCTCTGCTTCACCACCAG -3'
(R):5'- ACAAACATCTTGGCCTCTGTTC -3'
Posted On 2018-07-24