Incidental Mutation 'R6694:Or2y1g'
ID 528508
Institutional Source Beutler Lab
Gene Symbol Or2y1g
Ensembl Gene ENSMUSG00000059864
Gene Name olfactory receptor family 2 subfamily Y member 1G
Synonyms Olfr1393, MOR256-24, GA_x6K02T2QP88-6154577-6153642, MOR256-67_i
MMRRC Submission 044812-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R6694 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 49169131-49173596 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 49171379 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 135 (I135F)
Ref Sequence ENSEMBL: ENSMUSP00000149358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078932] [ENSMUST00000213323] [ENSMUST00000214170] [ENSMUST00000214598] [ENSMUST00000215861] [ENSMUST00000217275]
AlphaFold Q8VFA7
Predicted Effect probably benign
Transcript: ENSMUST00000078932
AA Change: I135F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000077962
Gene: ENSMUSG00000059864
AA Change: I135F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 230 3e-6 PFAM
Pfam:7tm_1 41 289 5.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213323
AA Change: I135F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213684
Predicted Effect probably benign
Transcript: ENSMUST00000214170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214516
Predicted Effect probably benign
Transcript: ENSMUST00000214598
Predicted Effect probably benign
Transcript: ENSMUST00000215861
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217626
Predicted Effect probably benign
Transcript: ENSMUST00000217275
Meta Mutation Damage Score 0.2881 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc1l2 G A 6: 48,907,480 (GRCm39) S160N probably benign Het
Arap3 A C 18: 38,124,590 (GRCm39) probably null Het
Arhgap10 A G 8: 78,137,692 (GRCm39) F300L probably benign Het
Ccdc116 T C 16: 16,960,655 (GRCm39) E54G probably benign Het
Cd53 T A 3: 106,674,702 (GRCm39) I122F probably benign Het
Ctnnd1 T C 2: 84,454,849 (GRCm39) probably benign Het
Ddx60 A G 8: 62,490,104 (GRCm39) D1691G probably damaging Het
Dnah11 T C 12: 118,150,617 (GRCm39) probably null Het
Exoc1 T A 5: 76,697,399 (GRCm39) M392K probably damaging Het
Exoc3l G C 8: 106,017,122 (GRCm39) R622G probably benign Het
Grid2 C G 6: 63,908,031 (GRCm39) R224G possibly damaging Het
Kif20a A G 18: 34,758,579 (GRCm39) E16G probably damaging Het
Kit T C 5: 75,801,417 (GRCm39) V568A possibly damaging Het
Lhx4 T C 1: 155,580,456 (GRCm39) S257G probably benign Het
Med18 C T 4: 132,187,293 (GRCm39) V114I probably benign Het
Mrps30 C T 13: 118,523,497 (GRCm39) V92M possibly damaging Het
Mtrr C T 13: 68,712,452 (GRCm39) V645I probably benign Het
Nuak2 T G 1: 132,260,048 (GRCm39) S609A probably damaging Het
Plk4 T C 3: 40,756,263 (GRCm39) V58A probably damaging Het
Polq T A 16: 36,835,535 (GRCm39) F145L probably null Het
Rab11fip2 T C 19: 59,925,707 (GRCm39) K170R probably damaging Het
Rapgef3 A G 15: 97,657,865 (GRCm39) V246A probably benign Het
Rc3h2 A G 2: 37,290,555 (GRCm39) S316P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Homo
Rsf1 GCGGCGGC GCGGCGGCGACGGCGGC 7: 97,229,135 (GRCm39) probably benign Het
Sae1 G T 7: 16,102,461 (GRCm39) A171E probably damaging Het
Semp2l2b T C 10: 21,943,620 (GRCm39) E120G probably damaging Het
Setd5 T A 6: 113,120,669 (GRCm39) N959K probably benign Het
Siae T A 9: 37,528,119 (GRCm39) Y31N probably damaging Het
Sit1 C T 4: 43,483,311 (GRCm39) G51D probably damaging Het
Slc5a11 A G 7: 122,867,012 (GRCm39) I436V possibly damaging Het
Tcfl5 A G 2: 180,264,447 (GRCm39) S470P probably damaging Het
Timd2 A T 11: 46,561,779 (GRCm39) C288* probably null Het
Timeless T G 10: 128,075,868 (GRCm39) probably null Het
Ubxn8 G T 8: 34,111,572 (GRCm39) Q274K possibly damaging Het
Usp29 A G 7: 6,965,276 (GRCm39) E373G probably benign Het
Zap70 A G 1: 36,821,598 (GRCm39) Y597C probably damaging Het
Zfp523 T G 17: 28,419,446 (GRCm39) Y195D probably damaging Het
Zfp74 G A 7: 29,634,559 (GRCm39) A383V probably damaging Het
Zfp93 A T 7: 23,975,338 (GRCm39) Q441L probably damaging Het
Zfp976 A T 7: 42,263,610 (GRCm39) Y76N probably damaging Het
Other mutations in Or2y1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Or2y1g APN 11 49,171,314 (GRCm39) missense possibly damaging 0.94
IGL02291:Or2y1g APN 11 49,171,812 (GRCm39) missense probably damaging 1.00
IGL03127:Or2y1g APN 11 49,171,599 (GRCm39) missense possibly damaging 0.88
R0580:Or2y1g UTSW 11 49,171,449 (GRCm39) missense probably damaging 0.97
R1985:Or2y1g UTSW 11 49,171,110 (GRCm39) missense probably damaging 1.00
R4812:Or2y1g UTSW 11 49,171,284 (GRCm39) missense possibly damaging 0.94
R5190:Or2y1g UTSW 11 49,171,209 (GRCm39) missense probably damaging 0.99
R6911:Or2y1g UTSW 11 49,171,634 (GRCm39) missense probably benign 0.22
R7012:Or2y1g UTSW 11 49,171,823 (GRCm39) missense probably benign 0.07
R7159:Or2y1g UTSW 11 49,171,185 (GRCm39) missense probably damaging 1.00
R7541:Or2y1g UTSW 11 49,171,160 (GRCm39) missense probably damaging 1.00
R7759:Or2y1g UTSW 11 49,171,463 (GRCm39) missense probably benign 0.00
R8767:Or2y1g UTSW 11 49,171,227 (GRCm39) missense possibly damaging 0.87
R9069:Or2y1g UTSW 11 49,171,247 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAACAGACCTTCGACTGCAC -3'
(R):5'- GCCACAAACATCTTGGCCTC -3'

Sequencing Primer
(F):5'- GGACCTCTGCTTCACCACCAG -3'
(R):5'- ACAAACATCTTGGCCTCTGTTC -3'
Posted On 2018-07-24