Incidental Mutation 'R6694:Rapgef3'
ID 528512
Institutional Source Beutler Lab
Gene Symbol Rapgef3
Ensembl Gene ENSMUSG00000022469
Gene Name Rap guanine nucleotide exchange factor (GEF) 3
Synonyms 2310016P22Rik, 9330170P05Rik, Epac1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock # R6694 (G1)
Quality Score 215.009
Status Validated
Chromosome 15
Chromosomal Location 97744770-97767972 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 97759984 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 246 (V246A)
Ref Sequence ENSEMBL: ENSMUSP00000118148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126854] [ENSMUST00000128775] [ENSMUST00000129223] [ENSMUST00000134371] [ENSMUST00000134885] [ENSMUST00000146620] [ENSMUST00000149419] [ENSMUST00000177352] [ENSMUST00000175894]
AlphaFold Q8VCC8
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123397
Predicted Effect probably benign
Transcript: ENSMUST00000126854
AA Change: V246A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000116426
Gene: ENSMUSG00000022469
AA Change: V246A

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 6e-45 BLAST
RasGEF 661 926 7.98e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128775
AA Change: V246A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000120126
Gene: ENSMUSG00000022469
AA Change: V246A

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 7e-45 BLAST
RasGEF 661 909 5.53e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129223
AA Change: V246A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000118148
Gene: ENSMUSG00000022469
AA Change: V246A

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 6e-45 BLAST
RasGEF 661 918 2.11e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134371
SMART Domains Protein: ENSMUSP00000122746
Gene: ENSMUSG00000022469

DomainStartEndE-ValueType
Blast:cNMP 1 24 9e-8 BLAST
PDB:3CF6|E 1 67 5e-12 PDB
Blast:RasGEFN 36 67 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000134885
SMART Domains Protein: ENSMUSP00000135317
Gene: ENSMUSG00000022469

DomainStartEndE-ValueType
RasGEF 1 216 2.91e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146214
Predicted Effect probably benign
Transcript: ENSMUST00000146620
SMART Domains Protein: ENSMUSP00000116673
Gene: ENSMUSG00000022469

DomainStartEndE-ValueType
DEP 69 144 2.05e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149373
Predicted Effect probably benign
Transcript: ENSMUST00000149419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153241
Predicted Effect probably benign
Transcript: ENSMUST00000177352
AA Change: V204A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000135238
Gene: ENSMUSG00000022469
AA Change: V204A

DomainStartEndE-ValueType
DEP 69 144 2.05e-25 SMART
low complexity region 155 166 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
cNMP 203 322 2.53e-12 SMART
RasGEFN 341 472 7.04e-10 SMART
Blast:RasGEF 505 602 3e-45 BLAST
RasGEF 619 884 7.98e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153464
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased induced neuron apoptosis. Mice homozygous for a different allele exhibit impaired glucose homeostasis with decreased insulin secretion, increased susceptibility to diet-induced obesity and streptozotocin-induced insulitis and hyperglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,546 S160N probably benign Het
4930444G20Rik T C 10: 22,067,721 E120G probably damaging Het
Arap3 A C 18: 37,991,537 probably null Het
Arhgap10 A G 8: 77,411,063 F300L probably benign Het
Ccdc116 T C 16: 17,142,791 E54G probably benign Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Ctnnd1 T C 2: 84,624,505 probably benign Het
Ddx60 A G 8: 62,037,070 D1691G probably damaging Het
Dnah11 T C 12: 118,186,882 probably null Het
Exoc1 T A 5: 76,549,552 M392K probably damaging Het
Exoc3l G C 8: 105,290,490 R622G probably benign Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Kif20a A G 18: 34,625,526 E16G probably damaging Het
Kit T C 5: 75,640,757 V568A possibly damaging Het
Lhx4 T C 1: 155,704,710 S257G probably benign Het
Med18 C T 4: 132,459,982 V114I probably benign Het
Mrps30 C T 13: 118,386,961 V92M possibly damaging Het
Mtrr C T 13: 68,564,333 V645I probably benign Het
Nuak2 T G 1: 132,332,310 S609A probably damaging Het
Olfr1393 A T 11: 49,280,552 I135F probably benign Het
Plk4 T C 3: 40,801,828 V58A probably damaging Het
Polq T A 16: 37,015,173 F145L probably null Het
Rab11fip2 T C 19: 59,937,275 K170R probably damaging Het
Rc3h2 A G 2: 37,400,543 S316P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 GCGGCGGC GCGGCGGCGACGGCGGC 7: 97,579,928 probably benign Het
Sae1 G T 7: 16,368,536 A171E probably damaging Het
Setd5 T A 6: 113,143,708 N959K probably benign Het
Siae T A 9: 37,616,823 Y31N probably damaging Het
Sit1 C T 4: 43,483,311 G51D probably damaging Het
Slc5a11 A G 7: 123,267,789 I436V possibly damaging Het
Tcfl5 A G 2: 180,622,654 S470P probably damaging Het
Timd2 A T 11: 46,670,952 C288* probably null Het
Timeless T G 10: 128,239,999 probably null Het
Ubxn8 G T 8: 33,621,544 Q274K possibly damaging Het
Usp29 A G 7: 6,962,277 E373G probably benign Het
Zap70 A G 1: 36,782,517 Y597C probably damaging Het
Zfp523 T G 17: 28,200,472 Y195D probably damaging Het
Zfp74 G A 7: 29,935,134 A383V probably damaging Het
Zfp93 A T 7: 24,275,913 Q441L probably damaging Het
Zfp976 A T 7: 42,614,186 Y76N probably damaging Het
Other mutations in Rapgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Rapgef3 APN 15 97748223 missense probably damaging 1.00
IGL01339:Rapgef3 APN 15 97758059 missense probably damaging 1.00
IGL01670:Rapgef3 APN 15 97749662 missense probably benign 0.15
IGL01902:Rapgef3 APN 15 97750300 missense probably benign 0.32
IGL02137:Rapgef3 APN 15 97750144 missense probably benign 0.08
IGL02419:Rapgef3 APN 15 97750290 missense probably benign 0.33
IGL02427:Rapgef3 APN 15 97747136 splice site probably null
IGL02648:Rapgef3 APN 15 97758392 missense probably damaging 1.00
IGL02834:Rapgef3 APN 15 97748265 missense probably damaging 0.98
IGL03389:Rapgef3 APN 15 97749516 missense probably damaging 1.00
IGL03055:Rapgef3 UTSW 15 97749489 splice site probably benign
R0394:Rapgef3 UTSW 15 97757819 intron probably benign
R0538:Rapgef3 UTSW 15 97757817 intron probably benign
R0744:Rapgef3 UTSW 15 97761585 splice site probably benign
R1288:Rapgef3 UTSW 15 97759342 missense probably benign 0.31
R1512:Rapgef3 UTSW 15 97757501 missense probably benign 0.24
R1676:Rapgef3 UTSW 15 97761182 missense probably benign 0.35
R1745:Rapgef3 UTSW 15 97750178 missense probably benign 0.22
R1928:Rapgef3 UTSW 15 97750033 missense probably damaging 1.00
R2063:Rapgef3 UTSW 15 97766961 missense probably damaging 1.00
R2067:Rapgef3 UTSW 15 97766961 missense probably damaging 1.00
R2092:Rapgef3 UTSW 15 97760723 missense probably damaging 1.00
R4358:Rapgef3 UTSW 15 97748648 missense probably benign 0.05
R4624:Rapgef3 UTSW 15 97758929 missense probably damaging 1.00
R4627:Rapgef3 UTSW 15 97758929 missense probably damaging 1.00
R4727:Rapgef3 UTSW 15 97760600 missense probably damaging 1.00
R4812:Rapgef3 UTSW 15 97753803 missense probably benign 0.21
R4928:Rapgef3 UTSW 15 97757375 missense probably damaging 1.00
R5161:Rapgef3 UTSW 15 97757725 missense probably damaging 1.00
R5442:Rapgef3 UTSW 15 97758861 missense probably damaging 0.99
R5652:Rapgef3 UTSW 15 97758437 missense probably benign 0.00
R5837:Rapgef3 UTSW 15 97757342 splice site probably benign
R6056:Rapgef3 UTSW 15 97758861 missense probably damaging 0.99
R6167:Rapgef3 UTSW 15 97767411 unclassified probably benign
R7039:Rapgef3 UTSW 15 97761568 missense probably benign 0.01
R7154:Rapgef3 UTSW 15 97753877 missense probably benign
R7380:Rapgef3 UTSW 15 97766791 missense probably benign 0.00
R7655:Rapgef3 UTSW 15 97761209 missense probably damaging 1.00
R7656:Rapgef3 UTSW 15 97761209 missense probably damaging 1.00
R7754:Rapgef3 UTSW 15 97757746 missense probably damaging 1.00
R7849:Rapgef3 UTSW 15 97758390 critical splice donor site probably null
R8061:Rapgef3 UTSW 15 97761520 missense probably benign
R8117:Rapgef3 UTSW 15 97750866 missense probably benign 0.01
R8179:Rapgef3 UTSW 15 97760740 missense probably benign 0.06
R8819:Rapgef3 UTSW 15 97748657 missense probably benign 0.39
R8820:Rapgef3 UTSW 15 97748657 missense probably benign 0.39
R8824:Rapgef3 UTSW 15 97766908 missense probably benign 0.39
RF024:Rapgef3 UTSW 15 97760740 missense probably benign 0.06
X0011:Rapgef3 UTSW 15 97761473 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGAGGTCTGGTGGTAAGAAAC -3'
(R):5'- AACCATTGGCTTGACTGATTGC -3'

Sequencing Primer
(F):5'- GTCCTAGATTCTATGAGCACCAGG -3'
(R):5'- ACTGATTGCTGTGGAGTGGCC -3'
Posted On 2018-07-24