Incidental Mutation 'R6694:Ccdc116'
ID528513
Institutional Source Beutler Lab
Gene Symbol Ccdc116
Ensembl Gene ENSMUSG00000022768
Gene Namecoiled-coil domain containing 116
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6694 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location17139064-17147229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17142791 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 54 (E54G)
Ref Sequence ENSEMBL: ENSMUSP00000156301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023452] [ENSMUST00000069064] [ENSMUST00000115709] [ENSMUST00000115711] [ENSMUST00000231493] [ENSMUST00000231597] [ENSMUST00000231708] [ENSMUST00000231726] [ENSMUST00000232033] [ENSMUST00000232344] [ENSMUST00000232479] [ENSMUST00000232540]
Predicted Effect probably benign
Transcript: ENSMUST00000023452
AA Change: E54G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023452
Gene: ENSMUSG00000022768
AA Change: E54G

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069064
SMART Domains Protein: ENSMUSP00000069864
Gene: ENSMUSG00000041774

DomainStartEndE-ValueType
Pfam:YdjC 7 288 1.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115709
AA Change: E54G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111374
Gene: ENSMUSG00000022768
AA Change: E54G

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115711
AA Change: E54G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111376
Gene: ENSMUSG00000022768
AA Change: E54G

DomainStartEndE-ValueType
Pfam:DUF4702 18 411 6.3e-223 PFAM
low complexity region 488 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231539
Predicted Effect probably benign
Transcript: ENSMUST00000231597
AA Change: E54G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000231708
Predicted Effect probably benign
Transcript: ENSMUST00000231726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231975
Predicted Effect probably benign
Transcript: ENSMUST00000232033
AA Change: E54G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000232344
Predicted Effect probably benign
Transcript: ENSMUST00000232479
Predicted Effect probably benign
Transcript: ENSMUST00000232540
AA Change: E54G

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,546 S160N probably benign Het
4930444G20Rik T C 10: 22,067,721 E120G probably damaging Het
Arap3 A C 18: 37,991,537 probably null Het
Arhgap10 A G 8: 77,411,063 F300L probably benign Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Ctnnd1 T C 2: 84,624,505 probably benign Het
Ddx60 A G 8: 62,037,070 D1691G probably damaging Het
Dnah11 T C 12: 118,186,882 probably null Het
Exoc1 T A 5: 76,549,552 M392K probably damaging Het
Exoc3l G C 8: 105,290,490 R622G probably benign Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Kif20a A G 18: 34,625,526 E16G probably damaging Het
Kit T C 5: 75,640,757 V568A possibly damaging Het
Lhx4 T C 1: 155,704,710 S257G probably benign Het
Med18 C T 4: 132,459,982 V114I probably benign Het
Mrps30 C T 13: 118,386,961 V92M possibly damaging Het
Mtrr C T 13: 68,564,333 V645I probably benign Het
Nuak2 T G 1: 132,332,310 S609A probably damaging Het
Olfr1393 A T 11: 49,280,552 I135F probably benign Het
Plk4 T C 3: 40,801,828 V58A probably damaging Het
Polq T A 16: 37,015,173 F145L probably null Het
Rab11fip2 T C 19: 59,937,275 K170R probably damaging Het
Rapgef3 A G 15: 97,759,984 V246A probably benign Het
Rc3h2 A G 2: 37,400,543 S316P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 GCGGCGGC GCGGCGGCGACGGCGGC 7: 97,579,928 probably benign Het
Sae1 G T 7: 16,368,536 A171E probably damaging Het
Setd5 T A 6: 113,143,708 N959K probably benign Het
Siae T A 9: 37,616,823 Y31N probably damaging Het
Sit1 C T 4: 43,483,311 G51D probably damaging Het
Slc5a11 A G 7: 123,267,789 I436V possibly damaging Het
Tcfl5 A G 2: 180,622,654 S470P probably damaging Het
Timd2 A T 11: 46,670,952 C288* probably null Het
Timeless T G 10: 128,239,999 probably null Het
Ubxn8 G T 8: 33,621,544 Q274K possibly damaging Het
Usp29 A G 7: 6,962,277 E373G probably benign Het
Zap70 A G 1: 36,782,517 Y597C probably damaging Het
Zfp523 T G 17: 28,200,472 Y195D probably damaging Het
Zfp74 G A 7: 29,935,134 A383V probably damaging Het
Zfp93 A T 7: 24,275,913 Q441L probably damaging Het
Zfp976 A T 7: 42,614,186 Y76N probably damaging Het
Other mutations in Ccdc116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Ccdc116 APN 16 17141992 missense probably damaging 1.00
IGL01905:Ccdc116 APN 16 17142561 missense probably damaging 0.99
IGL02751:Ccdc116 APN 16 17141972 missense probably benign 0.00
IGL03183:Ccdc116 APN 16 17142854 missense probably benign 0.07
R0009:Ccdc116 UTSW 16 17144039 missense probably damaging 1.00
R0009:Ccdc116 UTSW 16 17144039 missense probably damaging 1.00
R0122:Ccdc116 UTSW 16 17142734 missense probably damaging 1.00
R0219:Ccdc116 UTSW 16 17141612 missense possibly damaging 0.93
R1664:Ccdc116 UTSW 16 17142628 missense probably benign 0.02
R1718:Ccdc116 UTSW 16 17141908 missense probably benign
R2921:Ccdc116 UTSW 16 17142443 missense probably benign 0.02
R2922:Ccdc116 UTSW 16 17142443 missense probably benign 0.02
R2923:Ccdc116 UTSW 16 17142443 missense probably benign 0.02
R4119:Ccdc116 UTSW 16 17142187 missense probably damaging 1.00
R4223:Ccdc116 UTSW 16 17146945 unclassified probably benign
R5000:Ccdc116 UTSW 16 17141793 missense possibly damaging 0.95
R5293:Ccdc116 UTSW 16 17141787 missense possibly damaging 0.92
R5435:Ccdc116 UTSW 16 17142762 missense probably benign 0.38
R7215:Ccdc116 UTSW 16 17139928 missense probably damaging 1.00
R7247:Ccdc116 UTSW 16 17139691 missense possibly damaging 0.89
Z1088:Ccdc116 UTSW 16 17147171 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCGAGATCGATGCCTACTACTTG -3'
(R):5'- CTTACCCATTGCAGGCCATC -3'

Sequencing Primer
(F):5'- ACCTCCACGGGGTCTTGAATATC -3'
(R):5'- ATCCTGCCTGTTATGACTGCAAAG -3'
Posted On2018-07-24