Incidental Mutation 'R6694:Kif20a'
ID528516
Institutional Source Beutler Lab
Gene Symbol Kif20a
Ensembl Gene ENSMUSG00000003779
Gene Namekinesin family member 20A
SynonymsRabkinesin-6, Rab6kifl
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6694 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location34624624-34633265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34625526 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 16 (E16G)
Ref Sequence ENSEMBL: ENSMUSP00000130045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003876] [ENSMUST00000097626] [ENSMUST00000115765] [ENSMUST00000115766] [ENSMUST00000166044] [ENSMUST00000167161]
Predicted Effect probably benign
Transcript: ENSMUST00000003876
SMART Domains Protein: ENSMUSP00000003876
Gene: ENSMUSG00000003778

DomainStartEndE-ValueType
Blast:SANT 15 74 4e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 339 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
BROMO 778 886 7.59e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097626
SMART Domains Protein: ENSMUSP00000095229
Gene: ENSMUSG00000003778

DomainStartEndE-ValueType
Blast:SANT 15 74 3e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 290 305 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
low complexity region 686 700 N/A INTRINSIC
BROMO 705 813 7.59e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115765
SMART Domains Protein: ENSMUSP00000111431
Gene: ENSMUSG00000003778

DomainStartEndE-ValueType
Blast:SANT 15 74 5e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 339 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
BROMO 778 886 7.59e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115766
SMART Domains Protein: ENSMUSP00000111432
Gene: ENSMUSG00000003778

DomainStartEndE-ValueType
Blast:SANT 15 74 4e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 337 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
BROMO 708 816 7.59e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153569
Predicted Effect probably damaging
Transcript: ENSMUST00000166044
AA Change: E16G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132659
Gene: ENSMUSG00000003779
AA Change: E16G

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167161
AA Change: E16G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130045
Gene: ENSMUSG00000003779
AA Change: E16G

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,546 S160N probably benign Het
4930444G20Rik T C 10: 22,067,721 E120G probably damaging Het
Arap3 A C 18: 37,991,537 probably null Het
Arhgap10 A G 8: 77,411,063 F300L probably benign Het
Ccdc116 T C 16: 17,142,791 E54G probably benign Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Ctnnd1 T C 2: 84,624,505 probably benign Het
Ddx60 A G 8: 62,037,070 D1691G probably damaging Het
Dnah11 T C 12: 118,186,882 probably null Het
Exoc1 T A 5: 76,549,552 M392K probably damaging Het
Exoc3l G C 8: 105,290,490 R622G probably benign Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Kit T C 5: 75,640,757 V568A possibly damaging Het
Lhx4 T C 1: 155,704,710 S257G probably benign Het
Med18 C T 4: 132,459,982 V114I probably benign Het
Mrps30 C T 13: 118,386,961 V92M possibly damaging Het
Mtrr C T 13: 68,564,333 V645I probably benign Het
Nuak2 T G 1: 132,332,310 S609A probably damaging Het
Olfr1393 A T 11: 49,280,552 I135F probably benign Het
Plk4 T C 3: 40,801,828 V58A probably damaging Het
Polq T A 16: 37,015,173 F145L probably null Het
Rab11fip2 T C 19: 59,937,275 K170R probably damaging Het
Rapgef3 A G 15: 97,759,984 V246A probably benign Het
Rc3h2 A G 2: 37,400,543 S316P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 GCGGCGGC GCGGCGGCGACGGCGGC 7: 97,579,928 probably benign Het
Sae1 G T 7: 16,368,536 A171E probably damaging Het
Setd5 T A 6: 113,143,708 N959K probably benign Het
Siae T A 9: 37,616,823 Y31N probably damaging Het
Sit1 C T 4: 43,483,311 G51D probably damaging Het
Slc5a11 A G 7: 123,267,789 I436V possibly damaging Het
Tcfl5 A G 2: 180,622,654 S470P probably damaging Het
Timd2 A T 11: 46,670,952 C288* probably null Het
Timeless T G 10: 128,239,999 probably null Het
Ubxn8 G T 8: 33,621,544 Q274K possibly damaging Het
Usp29 A G 7: 6,962,277 E373G probably benign Het
Zap70 A G 1: 36,782,517 Y597C probably damaging Het
Zfp523 T G 17: 28,200,472 Y195D probably damaging Het
Zfp74 G A 7: 29,935,134 A383V probably damaging Het
Zfp93 A T 7: 24,275,913 Q441L probably damaging Het
Zfp976 A T 7: 42,614,186 Y76N probably damaging Het
Other mutations in Kif20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02448:Kif20a APN 18 34628454 missense possibly damaging 0.49
IGL02654:Kif20a APN 18 34632023 missense probably damaging 1.00
IGL02739:Kif20a APN 18 34628943 nonsense probably null
R0600:Kif20a UTSW 18 34629209 missense probably damaging 1.00
R0748:Kif20a UTSW 18 34628188 splice site probably benign
R0856:Kif20a UTSW 18 34631218 missense probably benign
R1278:Kif20a UTSW 18 34626777 missense probably benign 0.00
R1752:Kif20a UTSW 18 34631581 missense possibly damaging 0.82
R2036:Kif20a UTSW 18 34628462 missense possibly damaging 0.91
R2143:Kif20a UTSW 18 34625604 missense possibly damaging 0.55
R2144:Kif20a UTSW 18 34625604 missense possibly damaging 0.55
R4231:Kif20a UTSW 18 34632038 missense probably benign
R4372:Kif20a UTSW 18 34629478 missense probably damaging 1.00
R4426:Kif20a UTSW 18 34631941 missense probably damaging 1.00
R4584:Kif20a UTSW 18 34632611 missense probably damaging 1.00
R5524:Kif20a UTSW 18 34630625 critical splice donor site probably null
R5867:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5869:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5949:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5958:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5959:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5967:Kif20a UTSW 18 34630527 missense probably benign 0.10
R5969:Kif20a UTSW 18 34632415 missense probably benign 0.01
R6175:Kif20a UTSW 18 34628146 missense probably damaging 0.98
R6490:Kif20a UTSW 18 34629490 missense possibly damaging 0.84
R6866:Kif20a UTSW 18 34628493 missense probably benign 0.10
R7129:Kif20a UTSW 18 34632535 missense probably benign 0.00
R7217:Kif20a UTSW 18 34629560 missense probably benign 0.14
R7397:Kif20a UTSW 18 34627676 missense probably damaging 1.00
R7585:Kif20a UTSW 18 34625538 missense probably benign 0.03
R8302:Kif20a UTSW 18 34631977 missense probably damaging 1.00
R8306:Kif20a UTSW 18 34628391 missense probably benign 0.00
R8325:Kif20a UTSW 18 34626922 missense possibly damaging 0.68
R8697:Kif20a UTSW 18 34628531 missense probably benign 0.19
X0027:Kif20a UTSW 18 34625530 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCTTAGCTGATAGTGGTGTATAGTC -3'
(R):5'- CAGGATTACTGGCTTTTGATCTC -3'

Sequencing Primer
(F):5'- GGTGTATAGTCTAGGCATCCCAC -3'
(R):5'- ACCTTGTATAAACAACTGTTAGCTG -3'
Posted On2018-07-24