Incidental Mutation 'R6695:Lonrf2'
ID528519
Institutional Source Beutler Lab
Gene Symbol Lonrf2
Ensembl Gene ENSMUSG00000048814
Gene NameLON peptidase N-terminal domain and ring finger 2
Synonyms2900060P06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6695 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location38793645-38836711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38813389 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 127 (D127G)
Ref Sequence ENSEMBL: ENSMUSP00000117600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039612] [ENSMUST00000147695]
Predicted Effect probably benign
Transcript: ENSMUST00000039612
AA Change: D127G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047372
Gene: ENSMUSG00000048814
AA Change: D127G

DomainStartEndE-ValueType
Blast:TPR 22 55 2e-14 BLAST
low complexity region 72 87 N/A INTRINSIC
RING 213 250 1.54e-5 SMART
Pfam:LON 301 498 4.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147695
AA Change: D127G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117600
Gene: ENSMUSG00000048814
AA Change: D127G

DomainStartEndE-ValueType
Blast:TPR 22 55 2e-14 BLAST
low complexity region 72 87 N/A INTRINSIC
RING 213 250 1.54e-5 SMART
Pfam:LON_substr_bdg 301 498 2.6e-27 PFAM
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Cyp4f15 T A 17: 32,692,612 L156* probably null Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Galntl6 G T 8: 58,427,770 H116Q probably damaging Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Knstrn G A 2: 118,814,242 A48T probably damaging Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mia2 A G 12: 59,172,580 H454R probably damaging Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Muc15 A T 2: 110,731,271 L17F probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr1449 A T 19: 12,935,400 I221L possibly damaging Het
Olfr338 A T 2: 36,377,105 S110C probably benign Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Ppm1j A G 3: 104,785,486 D437G probably damaging Het
Rab11fip1 T C 8: 27,143,234 E1148G probably damaging Het
Rad9b T C 5: 122,351,691 N43S probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Sugct T G 13: 17,323,230 N286T possibly damaging Het
Swsap1 A T 9: 21,956,675 probably null Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tnrc6b A G 15: 80,879,773 D492G probably damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Vps52 A T 17: 33,963,199 K516* probably null Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Zfp607b T C 7: 27,704,039 V640A probably benign Het
Other mutations in Lonrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Lonrf2 APN 1 38812535 splice site probably benign
IGL02369:Lonrf2 APN 1 38811832 splice site probably benign
IGL02526:Lonrf2 APN 1 38800710 missense probably benign 0.02
gorged UTSW 1 38804336 missense probably benign 0.05
swollen UTSW 1 38813389 missense probably benign
R1450:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1527:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1541:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1655:Lonrf2 UTSW 1 38811824 missense probably damaging 0.98
R1679:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1681:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1711:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1732:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1758:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1768:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1795:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1831:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1832:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1833:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R2044:Lonrf2 UTSW 1 38807050 missense probably benign 0.17
R2054:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R2656:Lonrf2 UTSW 1 38815960 splice site probably null
R4084:Lonrf2 UTSW 1 38821151 missense probably benign 0.00
R4775:Lonrf2 UTSW 1 38818059 splice site probably null
R4796:Lonrf2 UTSW 1 38816038 missense probably benign 0.00
R5445:Lonrf2 UTSW 1 38807153 missense probably benign 0.05
R5875:Lonrf2 UTSW 1 38807047 missense probably benign 0.01
R5902:Lonrf2 UTSW 1 38807093 missense probably benign 0.17
R6441:Lonrf2 UTSW 1 38818123 missense possibly damaging 0.76
R6533:Lonrf2 UTSW 1 38813268 missense probably benign 0.08
R6930:Lonrf2 UTSW 1 38804336 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTTGGGAATCTTCTCAGGGG -3'
(R):5'- GTCTCCCTGGTACTAAGGTTAC -3'

Sequencing Primer
(F):5'- AATCTTCTCAGGGGTATTCGC -3'
(R):5'- GGCCTCACAAATGTTCAGCAGG -3'
Posted On2018-07-24