Incidental Mutation 'R6695:Ppm1j'
ID528528
Institutional Source Beutler Lab
Gene Symbol Ppm1j
Ensembl Gene ENSMUSG00000002228
Gene Nameprotein phosphatase 1J
Synonyms2310008J22Rik, Ppp2cz, PP2Czeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6695 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location104781056-104786018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104785486 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 437 (D437G)
Ref Sequence ENSEMBL: ENSMUSP00000002298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002298] [ENSMUST00000002303] [ENSMUST00000106787] [ENSMUST00000176347] [ENSMUST00000196817] [ENSMUST00000199824]
Predicted Effect probably damaging
Transcript: ENSMUST00000002298
AA Change: D437G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000002298
Gene: ENSMUSG00000002228
AA Change: D437G

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
PP2Cc 93 497 1.44e-32 SMART
PP2C_SIG 119 499 1.51e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000002303
SMART Domains Protein: ENSMUSP00000002303
Gene: ENSMUSG00000002233

DomainStartEndE-ValueType
RHO 8 181 9.45e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106787
SMART Domains Protein: ENSMUSP00000102399
Gene: ENSMUSG00000002233

DomainStartEndE-ValueType
RHO 8 181 9.45e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162644
Predicted Effect probably benign
Transcript: ENSMUST00000176347
SMART Domains Protein: ENSMUSP00000135659
Gene: ENSMUSG00000002233

DomainStartEndE-ValueType
RHO 8 148 7.45e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196817
SMART Domains Protein: ENSMUSP00000142697
Gene: ENSMUSG00000002233

DomainStartEndE-ValueType
RHO 8 181 9.45e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197264
Predicted Effect probably benign
Transcript: ENSMUST00000199824
SMART Domains Protein: ENSMUSP00000142855
Gene: ENSMUSG00000002233

DomainStartEndE-ValueType
RHO 8 118 1.4e-68 SMART
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the serine/threonine protein phosphatase. The mouse homolog of this gene apparently belongs to the protein phosphatase 2C family of genes. The exact function of this gene is not yet known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Cyp4f15 T A 17: 32,692,612 L156* probably null Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Galntl6 G T 8: 58,427,770 H116Q probably damaging Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Knstrn G A 2: 118,814,242 A48T probably damaging Het
Lonrf2 T C 1: 38,813,389 D127G probably benign Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mia2 A G 12: 59,172,580 H454R probably damaging Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Muc15 A T 2: 110,731,271 L17F probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr1449 A T 19: 12,935,400 I221L possibly damaging Het
Olfr338 A T 2: 36,377,105 S110C probably benign Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Rab11fip1 T C 8: 27,143,234 E1148G probably damaging Het
Rad9b T C 5: 122,351,691 N43S probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Sugct T G 13: 17,323,230 N286T possibly damaging Het
Swsap1 A T 9: 21,956,675 probably null Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tnrc6b A G 15: 80,879,773 D492G probably damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Vps52 A T 17: 33,963,199 K516* probably null Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Zfp607b T C 7: 27,704,039 V640A probably benign Het
Other mutations in Ppm1j
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01860:Ppm1j APN 3 104784092 missense probably damaging 1.00
IGL03088:Ppm1j APN 3 104785409 nonsense probably null
R0350:Ppm1j UTSW 3 104783371 missense probably benign 0.01
R5042:Ppm1j UTSW 3 104782720 missense probably null 0.67
R5113:Ppm1j UTSW 3 104784674 missense possibly damaging 0.80
R5870:Ppm1j UTSW 3 104785495 missense possibly damaging 0.95
R6145:Ppm1j UTSW 3 104781379 missense probably damaging 0.99
R6221:Ppm1j UTSW 3 104785776 missense possibly damaging 0.95
R6458:Ppm1j UTSW 3 104781244 missense probably benign
R7084:Ppm1j UTSW 3 104784960 missense probably damaging 0.99
R7323:Ppm1j UTSW 3 104784113 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTGAGCACACCTTCTTTC -3'
(R):5'- ACCTGCCAGGAGTACATGTG -3'

Sequencing Primer
(F):5'- AGTGAGCACACCTTCTTTCCTTTTAG -3'
(R):5'- TACGTATATGAGAAGACAGATACACG -3'
Posted On2018-07-24