Incidental Mutation 'R6695:Dmwd'
ID528534
Institutional Source Beutler Lab
Gene Symbol Dmwd
Ensembl Gene ENSMUSG00000030410
Gene Namedystrophia myotonica-containing WD repeat motif
SynonymsDm9, 59, DMR-N9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R6695 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19076227-19082776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19080727 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 434 (L434Q)
Ref Sequence ENSEMBL: ENSMUSP00000104119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000032570] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000108479] [ENSMUST00000122999] [ENSMUST00000154199]
Predicted Effect probably benign
Transcript: ENSMUST00000032568
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000032570
AA Change: L434Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032570
Gene: ENSMUSG00000030410
AA Change: L434Q

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 653 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108473
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108474
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108479
AA Change: L434Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104119
Gene: ENSMUSG00000030410
AA Change: L434Q

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 628 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122999
SMART Domains Protein: ENSMUSP00000123516
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
PDB:2VD5|B 32 139 3e-62 PDB
SCOP:d1koba_ 44 139 3e-21 SMART
Blast:S_TKc 71 139 7e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149188
Predicted Effect probably benign
Transcript: ENSMUST00000154199
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Meta Mutation Damage Score 0.8933 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Cyp4f15 T A 17: 32,692,612 L156* probably null Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Galntl6 G T 8: 58,427,770 H116Q probably damaging Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Knstrn G A 2: 118,814,242 A48T probably damaging Het
Lonrf2 T C 1: 38,813,389 D127G probably benign Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mia2 A G 12: 59,172,580 H454R probably damaging Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Muc15 A T 2: 110,731,271 L17F probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr1449 A T 19: 12,935,400 I221L possibly damaging Het
Olfr338 A T 2: 36,377,105 S110C probably benign Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Ppm1j A G 3: 104,785,486 D437G probably damaging Het
Rab11fip1 T C 8: 27,143,234 E1148G probably damaging Het
Rad9b T C 5: 122,351,691 N43S probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Sugct T G 13: 17,323,230 N286T possibly damaging Het
Swsap1 A T 9: 21,956,675 probably null Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tnrc6b A G 15: 80,879,773 D492G probably damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Vps52 A T 17: 33,963,199 K516* probably null Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Zfp607b T C 7: 27,704,039 V640A probably benign Het
Other mutations in Dmwd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Dmwd APN 7 19081234 unclassified probably null
IGL01668:Dmwd APN 7 19081155 missense probably damaging 1.00
IGL02705:Dmwd APN 7 19080844 missense probably benign 0.02
IGL03036:Dmwd APN 7 19081129 missense probably damaging 1.00
IGL03133:Dmwd APN 7 19076637 missense probably damaging 1.00
PIT4305001:Dmwd UTSW 7 19080718 missense probably damaging 0.99
R0172:Dmwd UTSW 7 19080342 missense probably damaging 1.00
R1619:Dmwd UTSW 7 19081034 unclassified probably benign
R2055:Dmwd UTSW 7 19076685 missense probably benign 0.34
R2058:Dmwd UTSW 7 19080727 missense probably damaging 1.00
R2403:Dmwd UTSW 7 19081159 missense possibly damaging 0.94
R2922:Dmwd UTSW 7 19076345 missense probably damaging 1.00
R3122:Dmwd UTSW 7 19080695 missense probably damaging 1.00
R4876:Dmwd UTSW 7 19080547 missense probably damaging 1.00
R4937:Dmwd UTSW 7 19081303 critical splice donor site probably null
R5018:Dmwd UTSW 7 19078119 missense probably damaging 0.99
R5034:Dmwd UTSW 7 19080294 missense probably damaging 1.00
R5165:Dmwd UTSW 7 19078035 intron probably benign
R5265:Dmwd UTSW 7 19080281 missense possibly damaging 0.89
R5559:Dmwd UTSW 7 19080438 missense probably damaging 0.99
R7106:Dmwd UTSW 7 19080529 missense probably damaging 1.00
R7208:Dmwd UTSW 7 19080309 missense probably benign 0.05
R7681:Dmwd UTSW 7 19081082 missense probably benign 0.23
R7683:Dmwd UTSW 7 19080735 missense probably damaging 1.00
R7760:Dmwd UTSW 7 19080735 missense probably damaging 1.00
R7763:Dmwd UTSW 7 19080340 missense probably damaging 1.00
R7814:Dmwd UTSW 7 19080843 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACGCTGTAGCCTTTGATCCC -3'
(R):5'- AGGCTCCATCGATGCACTAG -3'

Sequencing Primer
(F):5'- TGATCCCTACACCACTCGCG -3'
(R):5'- TCGATGCACTAGGCCCAC -3'
Posted On2018-07-24