Incidental Mutation 'R6695:Rab11fip1'
ID528541
Institutional Source Beutler Lab
Gene Symbol Rab11fip1
Ensembl Gene ENSMUSG00000031488
Gene NameRAB11 family interacting protein 1 (class I)
Synonyms4833414G05Rik, 2010200K21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R6695 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location27138773-27174646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27143234 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1148 (E1148G)
Ref Sequence ENSEMBL: ENSMUSP00000058042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033878] [ENSMUST00000054212] [ENSMUST00000209377]
Predicted Effect probably damaging
Transcript: ENSMUST00000033878
AA Change: E627G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033878
Gene: ENSMUSG00000031488
AA Change: E627G

DomainStartEndE-ValueType
C2 19 125 1.57e-13 SMART
low complexity region 173 185 N/A INTRINSIC
low complexity region 201 227 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 373 396 N/A INTRINSIC
low complexity region 423 438 N/A INTRINSIC
Pfam:RBD-FIP 588 635 6.1e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054212
AA Change: E1148G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058042
Gene: ENSMUSG00000031488
AA Change: E1148G

DomainStartEndE-ValueType
C2 19 125 1.57e-13 SMART
low complexity region 173 185 N/A INTRINSIC
low complexity region 201 227 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 373 396 N/A INTRINSIC
low complexity region 423 438 N/A INTRINSIC
low complexity region 582 600 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 745 757 N/A INTRINSIC
low complexity region 882 893 N/A INTRINSIC
low complexity region 976 983 N/A INTRINSIC
low complexity region 992 999 N/A INTRINSIC
Pfam:RBD-FIP 1109 1156 3.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181424
Predicted Effect probably benign
Transcript: ENSMUST00000209377
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the Rab11-family interacting proteins (Rab11-FIPs), which play a role in the Rab-11 mediated recycling of vesicles. The encoded protein may be involved in endocytic sorting, trafficking of proteins including integrin subunits and epidermal growth factor receptor (EGFR), and transport between the recycling endosome and the trans-Golgi network. Alternative splicing results in multiple transcript variants. A pseudogene is described on the X chromosome. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous knockout results in reduced metastatic potential of pancreatic adenocarcinoma (PDAC) tumor cells in KPC (PDAC model) mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Cyp4f15 T A 17: 32,692,612 L156* probably null Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Galntl6 G T 8: 58,427,770 H116Q probably damaging Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Knstrn G A 2: 118,814,242 A48T probably damaging Het
Lonrf2 T C 1: 38,813,389 D127G probably benign Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mia2 A G 12: 59,172,580 H454R probably damaging Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Muc15 A T 2: 110,731,271 L17F probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr1449 A T 19: 12,935,400 I221L possibly damaging Het
Olfr338 A T 2: 36,377,105 S110C probably benign Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Ppm1j A G 3: 104,785,486 D437G probably damaging Het
Rad9b T C 5: 122,351,691 N43S probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Sugct T G 13: 17,323,230 N286T possibly damaging Het
Swsap1 A T 9: 21,956,675 probably null Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tnrc6b A G 15: 80,879,773 D492G probably damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Vps52 A T 17: 33,963,199 K516* probably null Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Zfp607b T C 7: 27,704,039 V640A probably benign Het
Other mutations in Rab11fip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Rab11fip1 APN 8 27154776 missense possibly damaging 0.71
IGL01976:Rab11fip1 APN 8 27152797 missense possibly damaging 0.56
IGL02832:Rab11fip1 APN 8 27152812 missense possibly damaging 0.79
IGL02799:Rab11fip1 UTSW 8 27152760 missense probably benign 0.12
R0046:Rab11fip1 UTSW 8 27153121 missense probably damaging 0.99
R0046:Rab11fip1 UTSW 8 27153121 missense probably damaging 0.99
R0145:Rab11fip1 UTSW 8 27143324 missense probably damaging 1.00
R0243:Rab11fip1 UTSW 8 27152225 missense probably damaging 1.00
R0427:Rab11fip1 UTSW 8 27154492 missense probably damaging 0.99
R1341:Rab11fip1 UTSW 8 27143360 missense probably damaging 0.99
R1487:Rab11fip1 UTSW 8 27154212 missense probably damaging 0.99
R1509:Rab11fip1 UTSW 8 27153023 missense probably damaging 1.00
R1731:Rab11fip1 UTSW 8 27152410 missense probably damaging 0.98
R3832:Rab11fip1 UTSW 8 27152746 missense probably benign
R4157:Rab11fip1 UTSW 8 27152147 missense probably damaging 1.00
R4451:Rab11fip1 UTSW 8 27154477 missense probably damaging 1.00
R4595:Rab11fip1 UTSW 8 27154575 missense probably damaging 0.98
R4620:Rab11fip1 UTSW 8 27154215 missense probably damaging 1.00
R4753:Rab11fip1 UTSW 8 27152741 missense probably benign
R4834:Rab11fip1 UTSW 8 27153083 missense probably damaging 1.00
R4958:Rab11fip1 UTSW 8 27154813 missense probably damaging 0.99
R5102:Rab11fip1 UTSW 8 27156374 missense probably damaging 0.99
R5558:Rab11fip1 UTSW 8 27151975 missense probably damaging 1.00
R5752:Rab11fip1 UTSW 8 27156586 missense probably damaging 0.99
R5859:Rab11fip1 UTSW 8 27154720 missense probably damaging 1.00
R6525:Rab11fip1 UTSW 8 27156499 missense probably benign 0.45
R6527:Rab11fip1 UTSW 8 27174392 missense probably damaging 0.99
R6551:Rab11fip1 UTSW 8 27156484 missense probably damaging 0.96
R6730:Rab11fip1 UTSW 8 27143229 missense probably damaging 1.00
R6810:Rab11fip1 UTSW 8 27152732 frame shift probably null
R6925:Rab11fip1 UTSW 8 27152972 missense probably damaging 1.00
R6941:Rab11fip1 UTSW 8 27156275 nonsense probably null
R7481:Rab11fip1 UTSW 8 27156581 missense probably damaging 1.00
R7504:Rab11fip1 UTSW 8 27152953 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AACAAAACGCTGGGAGATGT -3'
(R):5'- TCTTCCTTCCCTCTCCAAAGAAA -3'

Sequencing Primer
(F):5'- CATTAATCTGGTTTTCAGCTAGGAG -3'
(R):5'- GAAATACCAGCCCTCGGATC -3'
Posted On2018-07-24