Incidental Mutation 'R6695:Swsap1'
ID528544
Institutional Source Beutler Lab
Gene Symbol Swsap1
Ensembl Gene ENSMUSG00000051238
Gene NameSWIM type zinc finger 7 associated protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6695 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location21955755-21958264 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 21956675 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000060331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006397] [ENSMUST00000053583] [ENSMUST00000213181]
Predicted Effect probably benign
Transcript: ENSMUST00000006397
SMART Domains Protein: ENSMUSP00000006397
Gene: ENSMUSG00000006235

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 37 139 9.1e-30 PFAM
FN3 144 227 2.48e-6 SMART
transmembrane domain 250 272 N/A INTRINSIC
low complexity region 434 451 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000053583
SMART Domains Protein: ENSMUSP00000060331
Gene: ENSMUSG00000051238

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
low complexity region 40 52 N/A INTRINSIC
Blast:AAA 53 189 3e-34 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000213181
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Cyp4f15 T A 17: 32,692,612 L156* probably null Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Galntl6 G T 8: 58,427,770 H116Q probably damaging Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Knstrn G A 2: 118,814,242 A48T probably damaging Het
Lonrf2 T C 1: 38,813,389 D127G probably benign Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mia2 A G 12: 59,172,580 H454R probably damaging Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Muc15 A T 2: 110,731,271 L17F probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr1449 A T 19: 12,935,400 I221L possibly damaging Het
Olfr338 A T 2: 36,377,105 S110C probably benign Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Ppm1j A G 3: 104,785,486 D437G probably damaging Het
Rab11fip1 T C 8: 27,143,234 E1148G probably damaging Het
Rad9b T C 5: 122,351,691 N43S probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Sugct T G 13: 17,323,230 N286T possibly damaging Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tnrc6b A G 15: 80,879,773 D492G probably damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Vps52 A T 17: 33,963,199 K516* probably null Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Zfp607b T C 7: 27,704,039 V640A probably benign Het
Other mutations in Swsap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01565:Swsap1 APN 9 21957228 missense possibly damaging 0.57
R0012:Swsap1 UTSW 9 21957022 missense probably benign 0.12
R1341:Swsap1 UTSW 9 21957154 missense probably benign 0.18
R1758:Swsap1 UTSW 9 21955984 nonsense probably null
R1905:Swsap1 UTSW 9 21956692 missense probably damaging 1.00
R4825:Swsap1 UTSW 9 21955988 missense probably benign 0.32
R5597:Swsap1 UTSW 9 21955946 missense probably damaging 1.00
Z1177:Swsap1 UTSW 9 21955975 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AGTGAAAGACCGTCCTGTGG -3'
(R):5'- GTATCCAGAAGCAATGCAGC -3'

Sequencing Primer
(F):5'- AGTTCTCAGAAGTGTCAGGCCATC -3'
(R):5'- CCAAGTAGGCGGCTTCCTG -3'
Posted On2018-07-24