Mutagenetix > Incidental Mutations

Incidental Mutation 'R6695:Tonsl'

528553

Institutional Source

Beutler Lab

Gene Symbol

Tonsl

Ensembl Gene

ENSMUSG00000059323

Gene Name

tonsoku-like, DNA repair protein

Synonyms

Nfkbil2, 2810439M11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6695 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76626002-76639958 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 76629818 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1184 (S1184T)

Ref Sequence

ENSEMBL: ENSMUSP00000129597 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078803] [ENSMUST00000165190] [ENSMUST00000168185] [ENSMUST00000229019]

Predicted Effect

probably benign
Transcript: ENSMUST00000078803

SMART Domains

Protein: ENSMUSP00000077856
Gene: ENSMUSG00000115987

Domain	Start	End	E-Value	Type
Pfam:VPS28	39	219	2.2e-70	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163990

Predicted Effect

probably benign
Transcript: ENSMUST00000165163

SMART Domains

Protein: ENSMUSP00000131229
Gene: ENSMUSG00000059323

Domain	Start	End	E-Value	Type
low complexity region	33	51	N/A	INTRINSIC
low complexity region	52	62	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165190

SMART Domains

Protein: ENSMUSP00000131368
Gene: ENSMUSG00000059323

Domain	Start	End	E-Value	Type
TPR	27	60	5.33e1	SMART
Blast:TPR	67	100	4e-9	BLAST
TPR	162	195	1.77e1	SMART
TPR	202	235	1.36e1	SMART
low complexity region	259	271	N/A	INTRINSIC
TPR	311	344	1.4e1	SMART
TPR	352	385	7.27e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168185
AA Change: S1184T

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000129597
Gene: ENSMUSG00000059323
AA Change: S1184T

Domain	Start	End	E-Value	Type
TPR	27	60	5.33e1	SMART
Blast:TPR	67	100	7e-9	BLAST
TPR	162	195	1.77e1	SMART
TPR	202	235	1.36e1	SMART
Pfam:TPR_8	242	274	8.7e-3	PFAM
TPR	311	344	1.4e1	SMART
TPR	352	385	7.27e0	SMART
low complexity region	413	437	N/A	INTRINSIC
low complexity region	465	494	N/A	INTRINSIC
low complexity region	500	511	N/A	INTRINSIC
ANK	528	559	8.36e1	SMART
ANK	561	590	4.85e-8	SMART
ANK	597	626	2.85e-5	SMART
low complexity region	690	707	N/A	INTRINSIC
low complexity region	729	753	N/A	INTRINSIC
low complexity region	1031	1044	N/A	INTRINSIC
LRR	1058	1085	2.86e-1	SMART
LRR	1086	1113	5.88e-1	SMART
LRR	1117	1144	1.67e-2	SMART
LRR	1177	1204	2.72e0	SMART
LRR	1236	1263	7.02e0	SMART
LRR	1264	1292	1.46e2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171478

Predicted Effect

probably benign
Transcript: ENSMUST00000229019

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229052

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229261

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229545

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a negative regulator of NF-kappa-B mediated transcription. The encoded protein may bind NF-kappa-B complexes and trap them in the cytoplasm, preventing them from entering the nucleus and interacting with the DNA. Phosphorylation of this protein targets it for degradation by the ubiquitination pathway, which frees the NF-kappa-B complexes to enter the nucleus. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd9	A	T	12: 110,977,063	L179H	probably benign	Het
Cacna1h	C	A	17: 25,393,740	A370S	probably damaging	Het
Cc2d2a	A	T	5: 43,718,677	I1053F	probably damaging	Het
Csmd3	A	G	15: 47,857,834	V1467A	probably damaging	Het
Cyp4f15	T	A	17: 32,692,612	L156*	probably null	Het
Dmwd	T	A	7: 19,080,727	L434Q	probably damaging	Het
Dtx4	T	A	19: 12,473,235	R538*	probably null	Het
Fcgbp	T	A	7: 28,086,270	C377*	probably null	Het
Galntl6	G	T	8: 58,427,770	H116Q	probably damaging	Het
Herc1	T	A	9: 66,483,866		probably null	Het
Hydin	T	G	8: 110,326,460	S255A	probably benign	Het
Knstrn	G	A	2: 118,814,242	A48T	probably damaging	Het
Lonrf2	T	C	1: 38,813,389	D127G	probably benign	Het
Luzp1	T	C	4: 136,545,298	S12P	possibly damaging	Het
Man2c1	A	T	9: 57,141,591	H822L	probably benign	Het
Map3k13	G	T	16: 21,922,278	G785V	probably benign	Het
Mia2	A	G	12: 59,172,580	H454R	probably damaging	Het
Mib2	G	A	4: 155,661,172	R61C	probably damaging	Het
Muc15	A	T	2: 110,731,271	L17F	probably damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Nav2	A	G	7: 49,464,904	I879V	probably benign	Het
Nomo1	T	A	7: 46,066,461	S751T	probably benign	Het
Olfr1449	A	T	19: 12,935,400	I221L	possibly damaging	Het
Olfr338	A	T	2: 36,377,105	S110C	probably benign	Het
Olfr996	A	G	2: 85,579,449	D70G	probably damaging	Het
Pcdhac2	A	G	18: 37,145,203	N412S	probably benign	Het
Plk5	T	C	10: 80,360,201	S235P	probably benign	Het
Ppm1j	A	G	3: 104,785,486	D437G	probably damaging	Het
Rab11fip1	T	C	8: 27,143,234	E1148G	probably damaging	Het
Rad9b	T	C	5: 122,351,691	N43S	probably damaging	Het
Rc3h2	A	C	2: 37,414,661	I29S	possibly damaging	Het
Rsf1	CG	CGACGGCGGGG	7: 97,579,908		probably benign	Homo
Spdl1	T	A	11: 34,823,003		probably null	Het
Spta1	A	T	1: 174,244,042		probably null	Het
Stk32c	A	T	7: 139,122,964	V53E	probably damaging	Het
Strc	A	T	2: 121,377,224	F555L	probably benign	Het
Sugct	T	G	13: 17,323,230	N286T	possibly damaging	Het
Swsap1	A	T	9: 21,956,675		probably null	Het
Thbs2	T	A	17: 14,674,164	D807V	possibly damaging	Het
Tnrc6b	A	G	15: 80,879,773	D492G	probably damaging	Het
Tpp2	T	A	1: 43,983,276	Y945N	probably benign	Het
Usp54	G	T	14: 20,560,869	A1293D	possibly damaging	Het
Vps52	A	T	17: 33,963,199	K516*	probably null	Het
Zbtb17	T	A	4: 141,461,799	V10D	probably damaging	Het
Zfp607b	T	C	7: 27,704,039	V640A	probably benign	Het

Other mutations in Tonsl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Tonsl	APN	15	76638496	missense	possibly damaging	0.78
IGL00763:Tonsl	APN	15	76633868	missense	probably damaging	1.00
IGL00796:Tonsl	APN	15	76625149	missense	probably benign
IGL00965:Tonsl	APN	15	76631880	splice site	probably benign
IGL01434:Tonsl	APN	15	76631102	missense	probably benign	0.11
IGL01859:Tonsl	APN	15	76634780	missense	probably damaging	0.97
IGL02112:Tonsl	APN	15	76633402	missense	probably benign	0.01
IGL02189:Tonsl	APN	15	76623178	missense	possibly damaging	0.56
IGL02281:Tonsl	APN	15	76634074	missense	probably damaging	1.00
IGL02627:Tonsl	APN	15	76634095	missense	probably damaging	0.99
IGL02750:Tonsl	APN	15	76633389	missense	probably damaging	0.97
IGL02977:Tonsl	APN	15	76632873	missense	probably benign	0.00
R0127:Tonsl	UTSW	15	76633485	missense	probably benign	0.01
R0316:Tonsl	UTSW	15	76629300	missense	possibly damaging	0.68
R0443:Tonsl	UTSW	15	76639684	missense	probably benign
R0714:Tonsl	UTSW	15	76633721	splice site	probably benign
R0946:Tonsl	UTSW	15	76623221	missense	probably benign	0.03
R0975:Tonsl	UTSW	15	76638932	missense	probably damaging	0.99
R1263:Tonsl	UTSW	15	76622562	missense	possibly damaging	0.85
R1468:Tonsl	UTSW	15	76636561	critical splice donor site	probably null
R1468:Tonsl	UTSW	15	76636561	critical splice donor site	probably null
R1610:Tonsl	UTSW	15	76638557	missense	probably damaging	1.00
R1623:Tonsl	UTSW	15	76638509	missense	probably damaging	1.00
R1763:Tonsl	UTSW	15	76638066	missense	probably damaging	1.00
R1882:Tonsl	UTSW	15	76624150	missense	possibly damaging	0.83
R1898:Tonsl	UTSW	15	76638853	unclassified	probably null
R1932:Tonsl	UTSW	15	76624597	missense	probably damaging	0.97
R2141:Tonsl	UTSW	15	76632661	missense	probably damaging	0.99
R2166:Tonsl	UTSW	15	76637313	missense	probably benign	0.13
R2191:Tonsl	UTSW	15	76632680	missense	probably damaging	0.96
R2198:Tonsl	UTSW	15	76636672	missense	probably benign	0.00
R2219:Tonsl	UTSW	15	76634640	missense	probably damaging	1.00
R2762:Tonsl	UTSW	15	76630620	missense	probably damaging	1.00
R3156:Tonsl	UTSW	15	76639521	missense	probably damaging	1.00
R3508:Tonsl	UTSW	15	76639756	missense	probably benign
R4012:Tonsl	UTSW	15	76637044	missense	probably damaging	1.00
R4179:Tonsl	UTSW	15	76624475	missense	probably damaging	1.00
R4180:Tonsl	UTSW	15	76624475	missense	probably damaging	1.00
R4327:Tonsl	UTSW	15	76639716	missense	probably benign
R4627:Tonsl	UTSW	15	76637224	missense	probably damaging	1.00
R4671:Tonsl	UTSW	15	76623410	missense	probably benign	0.01
R4825:Tonsl	UTSW	15	76633248	missense	probably benign	0.34
R4840:Tonsl	UTSW	15	76633209	missense	probably benign
R5030:Tonsl	UTSW	15	76638101	missense	probably damaging	1.00
R5143:Tonsl	UTSW	15	76636657	missense	possibly damaging	0.80
R6238:Tonsl	UTSW	15	76636218	unclassified	probably null
R6379:Tonsl	UTSW	15	76629742	missense	probably benign
R6401:Tonsl	UTSW	15	76633666	missense	probably damaging	1.00
R6534:Tonsl	UTSW	15	76629677	missense	probably damaging	1.00
R6701:Tonsl	UTSW	15	76629300	missense	probably damaging	1.00
R7138:Tonsl	UTSW	15	76634776	missense	probably benign
R7206:Tonsl	UTSW	15	76633651	missense	probably damaging	1.00
R7287:Tonsl	UTSW	15	76633725	intron	probably null
R7615:Tonsl	UTSW	15	76630607	missense	probably benign	0.44
R7626:Tonsl	UTSW	15	76633936	missense	probably null	1.00
R7641:Tonsl	UTSW	15	76633652	missense	probably damaging	1.00
Z1177:Tonsl	UTSW	15	76636153	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- TGGTTTGGCAGTCTACTCCATAC -3'
(R):5'- TGCCTACCAGCCAGGAATATG -3'

Sequencing Primer
(F):5'- ACCTCATACCTTGGTCAAGTATTTG -3'
(R):5'- ACTGGGCTTAGAGACTGGAC -3'

Posted On

2018-07-24