Incidental Mutation 'R6695:Tnrc6b'
ID 528554
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Name trinucleotide repeat containing 6b
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock # R6695 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 80711313-80941085 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80879773 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 492 (D492G)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689]
AlphaFold Q8BKI2
Predicted Effect probably damaging
Transcript: ENSMUST00000067689
AA Change: D492G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: D492G

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228071
Predicted Effect probably benign
Transcript: ENSMUST00000228124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228320
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Cyp4f15 T A 17: 32,692,612 L156* probably null Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Galntl6 G T 8: 58,427,770 H116Q probably damaging Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Knstrn G A 2: 118,814,242 A48T probably damaging Het
Lonrf2 T C 1: 38,813,389 D127G probably benign Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mia2 A G 12: 59,172,580 H454R probably damaging Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Muc15 A T 2: 110,731,271 L17F probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr1449 A T 19: 12,935,400 I221L possibly damaging Het
Olfr338 A T 2: 36,377,105 S110C probably benign Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Ppm1j A G 3: 104,785,486 D437G probably damaging Het
Rab11fip1 T C 8: 27,143,234 E1148G probably damaging Het
Rad9b T C 5: 122,351,691 N43S probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Sugct T G 13: 17,323,230 N286T possibly damaging Het
Swsap1 A T 9: 21,956,675 probably null Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Vps52 A T 17: 33,963,199 K516* probably null Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Zfp607b T C 7: 27,704,039 V640A probably benign Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 splice site probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
grosser UTSW 15 80929285 missense probably damaging 1.00
heiliger UTSW 15 80927741 critical splice donor site probably null
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0418:Tnrc6b UTSW 15 80913323 missense probably benign 0.27
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0528:Tnrc6b UTSW 15 80879403 missense probably benign 0.00
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1131:Tnrc6b UTSW 15 80894453 missense possibly damaging 0.45
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 splice site probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1965:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5380:Tnrc6b UTSW 15 80879565 missense possibly damaging 0.56
R5470:Tnrc6b UTSW 15 80916711 missense possibly damaging 0.89
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6622:Tnrc6b UTSW 15 80879184 missense probably damaging 0.99
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R6776:Tnrc6b UTSW 15 80924119 missense possibly damaging 0.87
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7287:Tnrc6b UTSW 15 80879541 missense possibly damaging 0.83
R7402:Tnrc6b UTSW 15 80884300 missense probably damaging 1.00
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
R7533:Tnrc6b UTSW 15 80927741 critical splice donor site probably null
R7571:Tnrc6b UTSW 15 80929393 missense probably benign
R7594:Tnrc6b UTSW 15 80880307 missense possibly damaging 0.66
R7831:Tnrc6b UTSW 15 80880379 missense possibly damaging 0.49
R8208:Tnrc6b UTSW 15 80858700 missense possibly damaging 0.53
R8276:Tnrc6b UTSW 15 80880717 missense probably benign 0.00
R8295:Tnrc6b UTSW 15 80913364 missense probably damaging 1.00
R8351:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
R8423:Tnrc6b UTSW 15 80929418 missense unknown
R8451:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
R8725:Tnrc6b UTSW 15 80876452 missense probably damaging 1.00
R8872:Tnrc6b UTSW 15 80918089 missense probably benign 0.23
R9029:Tnrc6b UTSW 15 80878978 missense possibly damaging 0.83
R9057:Tnrc6b UTSW 15 80879148 missense probably benign
R9240:Tnrc6b UTSW 15 80880061 missense probably damaging 0.98
R9450:Tnrc6b UTSW 15 80880436 missense probably benign 0.01
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Z1177:Tnrc6b UTSW 15 80858699 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TTAAGTTCACCAAACCCCATGG -3'
(R):5'- TTTCAACTCATCAGACCCAGTCG -3'

Sequencing Primer
(F):5'- CCCCATGGAAAATAAGGGAATGCC -3'
(R):5'- AGACCCAGTCGGCTGTTTC -3'
Posted On 2018-07-24