Incidental Mutation 'R6695:Vps52'
ID528559
Institutional Source Beutler Lab
Gene Symbol Vps52
Ensembl Gene ENSMUSG00000024319
Gene NameVPS52 GARP complex subunit
Synonymstclw5, ARE1, Sacm2l, D430041K17Rik, tcl-w5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6695 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33955812-33966984 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 33963199 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 516 (K516*)
Ref Sequence ENSEMBL: ENSMUSP00000133926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025178] [ENSMUST00000173196]
Predicted Effect probably null
Transcript: ENSMUST00000025178
AA Change: K584*
SMART Domains Protein: ENSMUSP00000025178
Gene: ENSMUSG00000024319
AA Change: K584*

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
low complexity region 24 45 N/A INTRINSIC
Pfam:Sec3_C 79 244 4.6e-13 PFAM
Pfam:Vps52 94 601 5.1e-233 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172558
Predicted Effect probably null
Transcript: ENSMUST00000173196
AA Change: K516*
SMART Domains Protein: ENSMUSP00000133926
Gene: ENSMUSG00000024319
AA Change: K516*

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
Pfam:Vps52 88 120 2.7e-6 PFAM
Pfam:Vps52 116 527 3e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174588
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the yeast suppressor of actin mutations 2 gene. The yeast protein forms a subunit of the tetrameric Golgi-associated retrograde protein complex that is involved in vesicle trafficking from from both early and late endosomes, back to the trans-Golgi network. This gene is located on chromosome 6 in a head-to-head orientation with the gene encoding ribosomal protein S18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Cyp4f15 T A 17: 32,692,612 L156* probably null Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Galntl6 G T 8: 58,427,770 H116Q probably damaging Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Knstrn G A 2: 118,814,242 A48T probably damaging Het
Lonrf2 T C 1: 38,813,389 D127G probably benign Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mia2 A G 12: 59,172,580 H454R probably damaging Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Muc15 A T 2: 110,731,271 L17F probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr1449 A T 19: 12,935,400 I221L possibly damaging Het
Olfr338 A T 2: 36,377,105 S110C probably benign Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Ppm1j A G 3: 104,785,486 D437G probably damaging Het
Rab11fip1 T C 8: 27,143,234 E1148G probably damaging Het
Rad9b T C 5: 122,351,691 N43S probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Sugct T G 13: 17,323,230 N286T possibly damaging Het
Swsap1 A T 9: 21,956,675 probably null Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tnrc6b A G 15: 80,879,773 D492G probably damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Zfp607b T C 7: 27,704,039 V640A probably benign Het
Other mutations in Vps52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Vps52 APN 17 33956958 missense possibly damaging 0.96
IGL01098:Vps52 APN 17 33962730 missense possibly damaging 0.90
IGL01705:Vps52 APN 17 33966068 missense probably damaging 1.00
IGL01722:Vps52 APN 17 33961615 nonsense probably null
IGL02992:Vps52 APN 17 33958350 missense probably damaging 0.97
IGL03279:Vps52 APN 17 33957874 missense probably damaging 0.96
R0363:Vps52 UTSW 17 33962117 missense probably benign 0.26
R0762:Vps52 UTSW 17 33960011 missense probably damaging 1.00
R1065:Vps52 UTSW 17 33961239 missense probably benign 0.02
R1506:Vps52 UTSW 17 33957894 missense probably damaging 1.00
R3760:Vps52 UTSW 17 33960188 missense possibly damaging 0.64
R4714:Vps52 UTSW 17 33961179 missense probably benign 0.25
R5381:Vps52 UTSW 17 33958301 missense possibly damaging 0.77
R5590:Vps52 UTSW 17 33961221 missense probably benign 0.01
R5928:Vps52 UTSW 17 33961126 missense possibly damaging 0.85
R6003:Vps52 UTSW 17 33956094 start codon destroyed probably null 0.01
R6302:Vps52 UTSW 17 33963215 missense probably damaging 1.00
R6574:Vps52 UTSW 17 33962478 missense probably null 0.34
R6888:Vps52 UTSW 17 33963206 missense probably benign 0.06
R7022:Vps52 UTSW 17 33959319 missense probably benign 0.04
R7136:Vps52 UTSW 17 33965288 missense probably benign 0.00
R7380:Vps52 UTSW 17 33958309 missense possibly damaging 0.82
R7727:Vps52 UTSW 17 33962134 missense probably benign 0.21
R7888:Vps52 UTSW 17 33965751 missense probably damaging 0.98
R7971:Vps52 UTSW 17 33965751 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATGGTAATGCTGCTCCTCC -3'
(R):5'- CAGGGCTATAGTACATGCACAC -3'

Sequencing Primer
(F):5'- AATGCTGCTCCTCCCACGG -3'
(R):5'- TGTAGCTATAGTACACACACATGC -3'
Posted On2018-07-24