Mutagenetix > Incidental Mutations

Incidental Mutation 'R6695:Vps52'

528559

Institutional Source

Beutler Lab

Gene Symbol

Vps52

Ensembl Gene

ENSMUSG00000024319

Gene Name

VPS52 GARP complex subunit

Synonyms

tclw5, ARE1, Sacm2l, D430041K17Rik, tcl-w5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6695 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33955812-33966984 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 33963199 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 516 (K516*)

Ref Sequence

ENSEMBL: ENSMUSP00000133926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025178] [ENSMUST00000173196]

Predicted Effect

probably null
Transcript: ENSMUST00000025178
AA Change: K584*

SMART Domains

Protein: ENSMUSP00000025178
Gene: ENSMUSG00000024319
AA Change: K584*

Domain	Start	End	E-Value	Type
low complexity region	1	11	N/A	INTRINSIC
low complexity region	24	45	N/A	INTRINSIC
Pfam:Sec3_C	79	244	4.6e-13	PFAM
Pfam:Vps52	94	601	5.1e-233	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122652

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172558

Predicted Effect

probably null
Transcript: ENSMUST00000173196
AA Change: K516*

SMART Domains

Protein: ENSMUSP00000133926
Gene: ENSMUSG00000024319
AA Change: K516*

Domain	Start	End	E-Value	Type
low complexity region	18	39	N/A	INTRINSIC
Pfam:Vps52	88	120	2.7e-6	PFAM
Pfam:Vps52	116	527	3e-181	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173318

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173445

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174588

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the yeast suppressor of actin mutations 2 gene. The yeast protein forms a subunit of the tetrameric Golgi-associated retrograde protein complex that is involved in vesicle trafficking from from both early and late endosomes, back to the trans-Golgi network. This gene is located on chromosome 6 in a head-to-head orientation with the gene encoding ribosomal protein S18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd9	A	T	12: 110,977,063	L179H	probably benign	Het
Cacna1h	C	A	17: 25,393,740	A370S	probably damaging	Het
Cc2d2a	A	T	5: 43,718,677	I1053F	probably damaging	Het
Csmd3	A	G	15: 47,857,834	V1467A	probably damaging	Het
Cyp4f15	T	A	17: 32,692,612	L156*	probably null	Het
Dmwd	T	A	7: 19,080,727	L434Q	probably damaging	Het
Dtx4	T	A	19: 12,473,235	R538*	probably null	Het
Fcgbp	T	A	7: 28,086,270	C377*	probably null	Het
Galntl6	G	T	8: 58,427,770	H116Q	probably damaging	Het
Herc1	T	A	9: 66,483,866		probably null	Het
Hydin	T	G	8: 110,326,460	S255A	probably benign	Het
Knstrn	G	A	2: 118,814,242	A48T	probably damaging	Het
Lonrf2	T	C	1: 38,813,389	D127G	probably benign	Het
Luzp1	T	C	4: 136,545,298	S12P	possibly damaging	Het
Man2c1	A	T	9: 57,141,591	H822L	probably benign	Het
Map3k13	G	T	16: 21,922,278	G785V	probably benign	Het
Mia2	A	G	12: 59,172,580	H454R	probably damaging	Het
Mib2	G	A	4: 155,661,172	R61C	probably damaging	Het
Muc15	A	T	2: 110,731,271	L17F	probably damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Nav2	A	G	7: 49,464,904	I879V	probably benign	Het
Nomo1	T	A	7: 46,066,461	S751T	probably benign	Het
Olfr1449	A	T	19: 12,935,400	I221L	possibly damaging	Het
Olfr338	A	T	2: 36,377,105	S110C	probably benign	Het
Olfr996	A	G	2: 85,579,449	D70G	probably damaging	Het
Pcdhac2	A	G	18: 37,145,203	N412S	probably benign	Het
Plk5	T	C	10: 80,360,201	S235P	probably benign	Het
Ppm1j	A	G	3: 104,785,486	D437G	probably damaging	Het
Rab11fip1	T	C	8: 27,143,234	E1148G	probably damaging	Het
Rad9b	T	C	5: 122,351,691	N43S	probably damaging	Het
Rc3h2	A	C	2: 37,414,661	I29S	possibly damaging	Het
Rsf1	CG	CGACGGCGGGG	7: 97,579,908		probably benign	Homo
Spdl1	T	A	11: 34,823,003		probably null	Het
Spta1	A	T	1: 174,244,042		probably null	Het
Stk32c	A	T	7: 139,122,964	V53E	probably damaging	Het
Strc	A	T	2: 121,377,224	F555L	probably benign	Het
Sugct	T	G	13: 17,323,230	N286T	possibly damaging	Het
Swsap1	A	T	9: 21,956,675		probably null	Het
Thbs2	T	A	17: 14,674,164	D807V	possibly damaging	Het
Tnrc6b	A	G	15: 80,879,773	D492G	probably damaging	Het
Tonsl	A	T	15: 76,629,818	S1184T	possibly damaging	Het
Tpp2	T	A	1: 43,983,276	Y945N	probably benign	Het
Usp54	G	T	14: 20,560,869	A1293D	possibly damaging	Het
Zbtb17	T	A	4: 141,461,799	V10D	probably damaging	Het
Zfp607b	T	C	7: 27,704,039	V640A	probably benign	Het

Other mutations in Vps52

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Vps52	APN	17	33956958	missense	possibly damaging	0.96
IGL01098:Vps52	APN	17	33962730	missense	possibly damaging	0.90
IGL01705:Vps52	APN	17	33966068	missense	probably damaging	1.00
IGL01722:Vps52	APN	17	33961615	nonsense	probably null
IGL02992:Vps52	APN	17	33958350	missense	probably damaging	0.97
IGL03279:Vps52	APN	17	33957874	missense	probably damaging	0.96
R0363:Vps52	UTSW	17	33962117	missense	probably benign	0.26
R0762:Vps52	UTSW	17	33960011	missense	probably damaging	1.00
R1065:Vps52	UTSW	17	33961239	missense	probably benign	0.02
R1506:Vps52	UTSW	17	33957894	missense	probably damaging	1.00
R3760:Vps52	UTSW	17	33960188	missense	possibly damaging	0.64
R4714:Vps52	UTSW	17	33961179	missense	probably benign	0.25
R5381:Vps52	UTSW	17	33958301	missense	possibly damaging	0.77
R5590:Vps52	UTSW	17	33961221	missense	probably benign	0.01
R5928:Vps52	UTSW	17	33961126	missense	possibly damaging	0.85
R6003:Vps52	UTSW	17	33956094	start codon destroyed	probably null	0.01
R6302:Vps52	UTSW	17	33963215	missense	probably damaging	1.00
R6574:Vps52	UTSW	17	33962478	missense	probably null	0.34
R6888:Vps52	UTSW	17	33963206	missense	probably benign	0.06
R7022:Vps52	UTSW	17	33959319	missense	probably benign	0.04
R7136:Vps52	UTSW	17	33965288	missense	probably benign	0.00
R7380:Vps52	UTSW	17	33958309	missense	possibly damaging	0.82
R7727:Vps52	UTSW	17	33962134	missense	probably benign	0.21
R7888:Vps52	UTSW	17	33965751	missense	probably damaging	0.98
R7971:Vps52	UTSW	17	33965751	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GATGGTAATGCTGCTCCTCC -3'
(R):5'- CAGGGCTATAGTACATGCACAC -3'

Sequencing Primer
(F):5'- AATGCTGCTCCTCCCACGG -3'
(R):5'- TGTAGCTATAGTACACACACATGC -3'

Posted On

2018-07-24