Incidental Mutation 'R6695:Olfr1449'
ID528562
Institutional Source Beutler Lab
Gene Symbol Olfr1449
Ensembl Gene ENSMUSG00000049498
Gene Nameolfactory receptor 1449
SynonymsGA_x6K02T2RE5P-3264213-3265157, MOR202-34
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6695 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12930840-12935752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12935400 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 221 (I221L)
Ref Sequence ENSEMBL: ENSMUSP00000148934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056005] [ENSMUST00000208624] [ENSMUST00000214079] [ENSMUST00000215325]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056005
AA Change: I221L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056181
Gene: ENSMUSG00000049498
AA Change: I221L

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4.5e-53 PFAM
Pfam:7tm_1 42 290 3.7e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000208624
AA Change: I221L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214079
AA Change: I221L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215325
AA Change: I221L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Cyp4f15 T A 17: 32,692,612 L156* probably null Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Galntl6 G T 8: 58,427,770 H116Q probably damaging Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Knstrn G A 2: 118,814,242 A48T probably damaging Het
Lonrf2 T C 1: 38,813,389 D127G probably benign Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mia2 A G 12: 59,172,580 H454R probably damaging Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Muc15 A T 2: 110,731,271 L17F probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr338 A T 2: 36,377,105 S110C probably benign Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Ppm1j A G 3: 104,785,486 D437G probably damaging Het
Rab11fip1 T C 8: 27,143,234 E1148G probably damaging Het
Rad9b T C 5: 122,351,691 N43S probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Sugct T G 13: 17,323,230 N286T possibly damaging Het
Swsap1 A T 9: 21,956,675 probably null Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tnrc6b A G 15: 80,879,773 D492G probably damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Vps52 A T 17: 33,963,199 K516* probably null Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Zfp607b T C 7: 27,704,039 V640A probably benign Het
Other mutations in Olfr1449
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Olfr1449 APN 19 12935562 missense probably damaging 0.98
IGL01943:Olfr1449 APN 19 12935674 missense probably benign 0.24
IGL02966:Olfr1449 APN 19 12934800 missense probably benign 0.08
IGL02974:Olfr1449 APN 19 12935035 missense probably benign 0.02
IGL03220:Olfr1449 APN 19 12935494 missense probably damaging 1.00
PIT4531001:Olfr1449 UTSW 19 12935277 missense probably damaging 0.98
R0285:Olfr1449 UTSW 19 12935172 missense probably benign 0.00
R0573:Olfr1449 UTSW 19 12935260 missense possibly damaging 0.77
R0588:Olfr1449 UTSW 19 12934747 missense probably benign 0.00
R0726:Olfr1449 UTSW 19 12935605 missense probably damaging 1.00
R1006:Olfr1449 UTSW 19 12935274 missense probably damaging 1.00
R1146:Olfr1449 UTSW 19 12934965 missense possibly damaging 0.77
R1146:Olfr1449 UTSW 19 12934965 missense possibly damaging 0.77
R1386:Olfr1449 UTSW 19 12935139 missense probably benign 0.17
R1735:Olfr1449 UTSW 19 12934843 missense probably damaging 1.00
R1794:Olfr1449 UTSW 19 12934968 missense probably damaging 0.97
R2355:Olfr1449 UTSW 19 12935019 missense possibly damaging 0.91
R2511:Olfr1449 UTSW 19 12935173 missense possibly damaging 0.85
R4673:Olfr1449 UTSW 19 12935097 missense probably damaging 1.00
R4749:Olfr1449 UTSW 19 12935217 missense probably benign 0.02
R4765:Olfr1449 UTSW 19 12935076 missense possibly damaging 0.65
R5112:Olfr1449 UTSW 19 12934816 missense probably benign 0.01
R5958:Olfr1449 UTSW 19 12935047 missense probably damaging 1.00
R6115:Olfr1449 UTSW 19 12935584 missense possibly damaging 0.54
R6152:Olfr1449 UTSW 19 12935487 missense probably benign 0.13
R6417:Olfr1449 UTSW 19 12935220 missense probably damaging 1.00
R6420:Olfr1449 UTSW 19 12935220 missense probably damaging 1.00
R6963:Olfr1449 UTSW 19 12935638 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTCTGCTATACATACTGGATTCACC -3'
(R):5'- GACAACTGGGTTCAACATGGG -3'

Sequencing Primer
(F):5'- GCTATACATACTGGATTCACCTTCTC -3'
(R):5'- ACTGGGTTCAACATGGGAACTATTG -3'
Posted On2018-07-24