Incidental Mutation 'R6696:Lrp4'
ID528567
Institutional Source Beutler Lab
Gene Symbol Lrp4
Ensembl Gene ENSMUSG00000027253
Gene Namelow density lipoprotein receptor-related protein 4
Synonymsmdig, Megf7
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.655) question?
Stock #R6696 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91457511-91513779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91497345 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1513 (D1513G)
Ref Sequence ENSEMBL: ENSMUSP00000028689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028689]
Predicted Effect probably benign
Transcript: ENSMUST00000028689
AA Change: D1513G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000028689
Gene: ENSMUSG00000027253
AA Change: D1513G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LDLa 26 68 5.77e-10 SMART
LDLa 70 107 4.05e-14 SMART
LDLa 109 145 1.9e-10 SMART
LDLa 147 184 1.51e-13 SMART
LDLa 190 227 6.83e-12 SMART
LDLa 230 267 2.45e-13 SMART
LDLa 269 306 6.32e-16 SMART
LDLa 311 351 3.24e-13 SMART
EGF 357 394 1.4e0 SMART
EGF_CA 395 434 1.05e-8 SMART
LY 460 502 7.01e-10 SMART
LY 503 545 4.41e-16 SMART
LY 546 589 1.04e-12 SMART
LY 590 632 5.07e-16 SMART
LY 633 674 3.12e-7 SMART
EGF 701 737 9.27e-1 SMART
LY 765 807 7.29e-8 SMART
LY 808 850 1.92e-16 SMART
LY 851 894 3.05e-10 SMART
LY 895 937 6.69e-16 SMART
LY 938 979 8.71e-6 SMART
EGF 1005 1044 1.64e-1 SMART
LY 1073 1115 2.58e-8 SMART
LY 1116 1158 1.57e-12 SMART
LY 1159 1202 7.4e-9 SMART
LY 1203 1245 9.39e-11 SMART
LY 1246 1285 6.11e-1 SMART
EGF 1312 1349 1.53e-1 SMART
LY 1377 1419 4.42e-7 SMART
LY 1420 1462 1.04e-12 SMART
LY 1463 1506 2.11e-13 SMART
LY 1507 1549 4.66e-15 SMART
LY 1550 1590 2.02e-1 SMART
EGF_like 1616 1649 5.79e1 SMART
low complexity region 1674 1690 N/A INTRINSIC
transmembrane domain 1724 1746 N/A INTRINSIC
low complexity region 1857 1870 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor-related protein family. The encoded protein may be a regulator of Wnt signaling. Mutations in this gene are associated with Cenani-Lenz syndrome. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations of this gene cause polysyndactyly. Additional phenotypes may include growth retardation, abnormal incisor development, kidney agenesis, and neonatal lethality associated with respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap25 G T 6: 87,465,651 H350Q probably damaging Het
Arhgap25 C A 6: 87,466,563 V305F probably damaging Het
Atg3 A T 16: 45,175,281 I126F possibly damaging Het
Best2 A T 8: 85,011,244 L174* probably null Het
Ccdc134 T A 15: 82,131,521 D67E probably damaging Het
Coasy G T 11: 101,083,101 R31L possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Eipr1 C A 12: 28,859,358 T208N probably benign Het
Epha2 A G 4: 141,321,539 T606A probably benign Het
Fan1 A T 7: 64,350,078 I853N probably damaging Het
Fbxw18 A C 9: 109,688,764 S385A probably benign Het
Galnt11 T C 5: 25,255,114 V307A probably benign Het
Gata3 A T 2: 9,874,492 Y224* probably null Het
Gm4756 C T 12: 72,619,481 A139T possibly damaging Het
Gm527 T C 12: 64,921,092 M96T possibly damaging Het
Hivep2 T C 10: 14,133,759 F1720S probably benign Het
Hltf T G 3: 20,065,306 probably null Het
Imp4 T C 1: 34,444,246 V247A probably benign Het
Iqca G A 1: 90,130,200 T259I probably benign Het
Klra6 A G 6: 130,016,733 F192L probably benign Het
Lnp1 T C 16: 56,927,786 K48E possibly damaging Het
Lrrc25 G A 8: 70,618,365 probably null Het
Macf1 T A 4: 123,509,803 Y590F probably damaging Het
Mms19 C A 19: 41,954,013 V359L probably benign Het
Mns1 G A 9: 72,452,762 R398Q probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nme3 G T 17: 24,897,294 C158F possibly damaging Het
Pam T A 1: 97,885,727 H326L possibly damaging Het
Plcxd1 A G 5: 110,101,885 N151S possibly damaging Het
Prep A T 10: 45,153,078 N525Y probably damaging Het
Rab11fip5 T C 6: 85,341,946 I654V possibly damaging Het
Sbf2 T A 7: 110,560,298 Q35L probably benign Het
Shcbp1 A G 8: 4,739,262 F519S probably damaging Het
Slc18a3 T C 14: 32,464,313 I38V possibly damaging Het
Slc5a2 A T 7: 128,270,043 I332F probably damaging Het
Slc7a7 C T 14: 54,377,761 probably null Het
Srbd1 C T 17: 86,139,191 V47I possibly damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tgfbr3 C T 5: 107,136,930 V618I probably benign Het
Tmem191c C T 16: 17,283,022 probably null Het
Tmem67 C A 4: 12,061,754 probably null Het
Tmem94 C T 11: 115,791,988 A617V probably damaging Het
Vmn1r71 T A 7: 10,748,474 I96F probably damaging Het
Vmn2r7 A T 3: 64,707,074 F440I probably benign Het
Wdr7 A G 18: 63,739,330 Q445R probably benign Het
Wnk1 A G 6: 119,948,282 L1407P probably damaging Het
Other mutations in Lrp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Lrp4 APN 2 91495026 missense probably benign
IGL00509:Lrp4 APN 2 91486174 splice site probably benign
IGL01145:Lrp4 APN 2 91487051 missense probably damaging 1.00
IGL01287:Lrp4 APN 2 91473948 missense probably damaging 1.00
IGL01531:Lrp4 APN 2 91511553 missense probably damaging 1.00
IGL01534:Lrp4 APN 2 91473641 missense probably damaging 1.00
IGL01544:Lrp4 APN 2 91477551 missense probably damaging 1.00
IGL01761:Lrp4 APN 2 91481981 critical splice donor site probably null
IGL01885:Lrp4 APN 2 91501107 missense probably benign 0.05
IGL01909:Lrp4 APN 2 91494184 missense possibly damaging 0.50
IGL02111:Lrp4 APN 2 91506059 missense probably damaging 1.00
IGL02385:Lrp4 APN 2 91474720 missense possibly damaging 0.89
IGL02403:Lrp4 APN 2 91508582 missense probably benign 0.05
IGL02431:Lrp4 APN 2 91476637 missense possibly damaging 0.95
IGL02452:Lrp4 APN 2 91474002 missense probably damaging 1.00
IGL02798:Lrp4 APN 2 91476710 missense probably benign 0.02
IGL02828:Lrp4 APN 2 91475294 missense probably benign
IGL02832:Lrp4 APN 2 91511580 missense probably damaging 1.00
IGL02893:Lrp4 APN 2 91474816 missense possibly damaging 0.76
F5770:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
R0037:Lrp4 UTSW 2 91471203 missense probably benign 0.22
R0037:Lrp4 UTSW 2 91471203 missense probably benign 0.22
R0137:Lrp4 UTSW 2 91494982 missense probably damaging 1.00
R0265:Lrp4 UTSW 2 91490670 missense probably damaging 1.00
R0368:Lrp4 UTSW 2 91477734 missense probably damaging 0.99
R0531:Lrp4 UTSW 2 91475178 splice site probably benign
R0827:Lrp4 UTSW 2 91495041 missense probably damaging 1.00
R1029:Lrp4 UTSW 2 91487027 splice site probably benign
R1183:Lrp4 UTSW 2 91477519 critical splice acceptor site probably null
R1587:Lrp4 UTSW 2 91476305 missense probably benign 0.26
R1693:Lrp4 UTSW 2 91492353 missense probably damaging 1.00
R1747:Lrp4 UTSW 2 91492621 missense probably damaging 0.98
R1863:Lrp4 UTSW 2 91498363 missense probably benign 0.15
R1908:Lrp4 UTSW 2 91498408 missense possibly damaging 0.93
R1909:Lrp4 UTSW 2 91498408 missense possibly damaging 0.93
R1932:Lrp4 UTSW 2 91497355 nonsense probably null
R1934:Lrp4 UTSW 2 91480432 missense probably damaging 1.00
R2358:Lrp4 UTSW 2 91501954 missense probably benign 0.01
R2433:Lrp4 UTSW 2 91506015 missense probably benign 0.00
R2698:Lrp4 UTSW 2 91475212 missense probably damaging 0.99
R2919:Lrp4 UTSW 2 91490730 missense probably benign 0.01
R3105:Lrp4 UTSW 2 91501049 missense probably benign
R3709:Lrp4 UTSW 2 91490466 missense possibly damaging 0.60
R3711:Lrp4 UTSW 2 91501954 missense probably benign 0.01
R3735:Lrp4 UTSW 2 91498371 missense probably damaging 1.00
R3808:Lrp4 UTSW 2 91476702 missense probably damaging 0.99
R3894:Lrp4 UTSW 2 91473949 missense probably damaging 1.00
R3895:Lrp4 UTSW 2 91473949 missense probably damaging 1.00
R4397:Lrp4 UTSW 2 91511670 missense probably benign 0.20
R4741:Lrp4 UTSW 2 91511567 missense probably damaging 1.00
R4948:Lrp4 UTSW 2 91485886 missense probably benign
R5050:Lrp4 UTSW 2 91492422 missense probably benign 0.22
R5096:Lrp4 UTSW 2 91485792 missense possibly damaging 0.65
R5110:Lrp4 UTSW 2 91497072 missense possibly damaging 0.48
R5141:Lrp4 UTSW 2 91478678 splice site probably benign
R5439:Lrp4 UTSW 2 91497073 missense probably benign 0.14
R5725:Lrp4 UTSW 2 91494895 missense probably damaging 1.00
R5795:Lrp4 UTSW 2 91474471 missense probably benign 0.01
R5820:Lrp4 UTSW 2 91492615 missense probably damaging 0.99
R5883:Lrp4 UTSW 2 91488433 missense probably benign 0.01
R5919:Lrp4 UTSW 2 91473207 missense probably damaging 1.00
R5925:Lrp4 UTSW 2 91511684 missense probably benign 0.01
R6080:Lrp4 UTSW 2 91502000 missense probably benign
R6189:Lrp4 UTSW 2 91475234 missense possibly damaging 0.63
R6192:Lrp4 UTSW 2 91508488 missense probably benign 0.00
R6319:Lrp4 UTSW 2 91480321 missense probably damaging 1.00
R6378:Lrp4 UTSW 2 91493829 missense probably benign 0.18
R6479:Lrp4 UTSW 2 91487084 missense probably damaging 0.96
R6500:Lrp4 UTSW 2 91492420 missense possibly damaging 0.90
R6643:Lrp4 UTSW 2 91501995 missense probably benign
R6657:Lrp4 UTSW 2 91492053 missense probably benign 0.00
R6714:Lrp4 UTSW 2 91476365 missense possibly damaging 0.90
R6734:Lrp4 UTSW 2 91485897 missense possibly damaging 0.79
R6770:Lrp4 UTSW 2 91497303 missense probably benign 0.33
R6774:Lrp4 UTSW 2 91511504 missense probably benign 0.01
R6957:Lrp4 UTSW 2 91487042 missense probably damaging 0.99
R6978:Lrp4 UTSW 2 91491998 missense probably damaging 1.00
R7065:Lrp4 UTSW 2 91511580 missense probably damaging 1.00
R7142:Lrp4 UTSW 2 91494994 missense probably damaging 0.99
R7219:Lrp4 UTSW 2 91492023 missense probably damaging 1.00
R7237:Lrp4 UTSW 2 91473183 missense probably benign 0.04
R7387:Lrp4 UTSW 2 91476614 missense probably benign
R7585:Lrp4 UTSW 2 91492588 missense probably damaging 1.00
R7835:Lrp4 UTSW 2 91495042 missense possibly damaging 0.82
R7872:Lrp4 UTSW 2 91490716 missense possibly damaging 0.54
R7918:Lrp4 UTSW 2 91495042 missense possibly damaging 0.82
R7955:Lrp4 UTSW 2 91490716 missense possibly damaging 0.54
V7580:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7581:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7582:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7583:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
X0021:Lrp4 UTSW 2 91501062 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGAGTTCCAGTCTAGAAGGGACT -3'
(R):5'- GACTGCATTGTCTTACCCCT -3'

Sequencing Primer
(F):5'- GCAGCTCCCAGAATGTGTTTACAG -3'
(R):5'- GCATTGTCTTACCCCTTTCCCTG -3'
Posted On2018-07-24