Incidental Mutation 'R6696:Tmem94'
ID528595
Institutional Source Beutler Lab
Gene Symbol Tmem94
Ensembl Gene ENSMUSG00000020747
Gene Nametransmembrane protein 94
Synonyms2310067B10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R6696 (G1)
Quality Score182.009
Status Validated
Chromosome11
Chromosomal Location115765433-115799366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115791988 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 617 (A617V)
Ref Sequence ENSEMBL: ENSMUSP00000099322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093912] [ENSMUST00000103033] [ENSMUST00000125918]
Predicted Effect probably damaging
Transcript: ENSMUST00000093912
AA Change: A617V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091440
Gene: ENSMUSG00000020747
AA Change: A617V

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
SCOP:d1eula_ 979 1282 6e-10 SMART
transmembrane domain 1310 1332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103033
AA Change: A617V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099322
Gene: ENSMUSG00000020747
AA Change: A617V

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
low complexity region 1096 1109 N/A INTRINSIC
Pfam:Cation_ATPase_C 1120 1334 5.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125918
SMART Domains Protein: ENSMUSP00000116666
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 105 115 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175989
Meta Mutation Damage Score 0.1154 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap25 G T 6: 87,465,651 H350Q probably damaging Het
Arhgap25 C A 6: 87,466,563 V305F probably damaging Het
Atg3 A T 16: 45,175,281 I126F possibly damaging Het
Best2 A T 8: 85,011,244 L174* probably null Het
Ccdc134 T A 15: 82,131,521 D67E probably damaging Het
Coasy G T 11: 101,083,101 R31L possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Eipr1 C A 12: 28,859,358 T208N probably benign Het
Epha2 A G 4: 141,321,539 T606A probably benign Het
Fan1 A T 7: 64,350,078 I853N probably damaging Het
Fbxw18 A C 9: 109,688,764 S385A probably benign Het
Galnt11 T C 5: 25,255,114 V307A probably benign Het
Gata3 A T 2: 9,874,492 Y224* probably null Het
Gm4756 C T 12: 72,619,481 A139T possibly damaging Het
Gm527 T C 12: 64,921,092 M96T possibly damaging Het
Hivep2 T C 10: 14,133,759 F1720S probably benign Het
Hltf T G 3: 20,065,306 probably null Het
Imp4 T C 1: 34,444,246 V247A probably benign Het
Iqca G A 1: 90,130,200 T259I probably benign Het
Klra6 A G 6: 130,016,733 F192L probably benign Het
Lnp1 T C 16: 56,927,786 K48E possibly damaging Het
Lrp4 A G 2: 91,497,345 D1513G probably benign Het
Lrrc25 G A 8: 70,618,365 probably null Het
Macf1 T A 4: 123,509,803 Y590F probably damaging Het
Mms19 C A 19: 41,954,013 V359L probably benign Het
Mns1 G A 9: 72,452,762 R398Q probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nme3 G T 17: 24,897,294 C158F possibly damaging Het
Pam T A 1: 97,885,727 H326L possibly damaging Het
Plcxd1 A G 5: 110,101,885 N151S possibly damaging Het
Prep A T 10: 45,153,078 N525Y probably damaging Het
Rab11fip5 T C 6: 85,341,946 I654V possibly damaging Het
Sbf2 T A 7: 110,560,298 Q35L probably benign Het
Shcbp1 A G 8: 4,739,262 F519S probably damaging Het
Slc18a3 T C 14: 32,464,313 I38V possibly damaging Het
Slc5a2 A T 7: 128,270,043 I332F probably damaging Het
Slc7a7 C T 14: 54,377,761 probably null Het
Srbd1 C T 17: 86,139,191 V47I possibly damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tgfbr3 C T 5: 107,136,930 V618I probably benign Het
Tmem191c C T 16: 17,283,022 probably null Het
Tmem67 C A 4: 12,061,754 probably null Het
Vmn1r71 T A 7: 10,748,474 I96F probably damaging Het
Vmn2r7 A T 3: 64,707,074 F440I probably benign Het
Wdr7 A G 18: 63,739,330 Q445R probably benign Het
Wnk1 A G 6: 119,948,282 L1407P probably damaging Het
Other mutations in Tmem94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Tmem94 APN 11 115795328 missense probably damaging 0.99
IGL01086:Tmem94 APN 11 115790284 missense probably benign 0.25
IGL01314:Tmem94 APN 11 115790009 missense probably damaging 0.99
IGL02123:Tmem94 APN 11 115787538 missense possibly damaging 0.51
IGL02355:Tmem94 APN 11 115794745 missense probably damaging 1.00
IGL02362:Tmem94 APN 11 115794745 missense probably damaging 1.00
IGL02366:Tmem94 APN 11 115797432 missense probably damaging 0.98
IGL02450:Tmem94 APN 11 115793071 missense probably damaging 1.00
IGL02623:Tmem94 APN 11 115796401 nonsense probably null
IGL02816:Tmem94 APN 11 115788704 unclassified probably null
IGL02836:Tmem94 APN 11 115792939 missense probably damaging 1.00
IGL03061:Tmem94 APN 11 115792421 missense possibly damaging 0.94
IGL03109:Tmem94 APN 11 115792398 missense probably damaging 1.00
IGL03255:Tmem94 APN 11 115792068 unclassified probably benign
IGL03397:Tmem94 APN 11 115787568 unclassified probably benign
capitulate UTSW 11 115796746 missense probably damaging 1.00
R0083:Tmem94 UTSW 11 115796724 unclassified probably benign
R0336:Tmem94 UTSW 11 115787385 missense probably benign
R0370:Tmem94 UTSW 11 115788717 missense probably damaging 1.00
R0494:Tmem94 UTSW 11 115794781 splice site probably null
R0638:Tmem94 UTSW 11 115792060 unclassified probably null
R0647:Tmem94 UTSW 11 115796795 missense probably damaging 1.00
R0900:Tmem94 UTSW 11 115791978 missense probably benign 0.00
R1469:Tmem94 UTSW 11 115795091 unclassified probably benign
R1616:Tmem94 UTSW 11 115796145 critical splice donor site probably null
R1621:Tmem94 UTSW 11 115785845 missense probably benign
R1682:Tmem94 UTSW 11 115790230 missense probably damaging 1.00
R1723:Tmem94 UTSW 11 115794748 missense probably damaging 1.00
R1760:Tmem94 UTSW 11 115796754 missense probably damaging 1.00
R1826:Tmem94 UTSW 11 115793213 nonsense probably null
R1926:Tmem94 UTSW 11 115792900 missense possibly damaging 0.67
R1956:Tmem94 UTSW 11 115788674 missense possibly damaging 0.75
R2033:Tmem94 UTSW 11 115794328 missense possibly damaging 0.65
R2135:Tmem94 UTSW 11 115794749 missense probably benign
R2419:Tmem94 UTSW 11 115796815 missense probably damaging 1.00
R2511:Tmem94 UTSW 11 115791961 missense probably damaging 1.00
R3932:Tmem94 UTSW 11 115789254 missense probably benign 0.00
R4708:Tmem94 UTSW 11 115786295 missense possibly damaging 0.87
R4812:Tmem94 UTSW 11 115796112 nonsense probably null
R5026:Tmem94 UTSW 11 115793104 missense probably damaging 1.00
R5714:Tmem94 UTSW 11 115793190 missense probably benign 0.04
R5716:Tmem94 UTSW 11 115792428 missense probably benign 0.17
R6180:Tmem94 UTSW 11 115791031 critical splice acceptor site probably null
R6295:Tmem94 UTSW 11 115796746 missense probably damaging 1.00
R6594:Tmem94 UTSW 11 115798286 missense probably damaging 1.00
R6883:Tmem94 UTSW 11 115796461 missense probably damaging 1.00
R6939:Tmem94 UTSW 11 115785830 missense possibly damaging 0.47
R7060:Tmem94 UTSW 11 115792938 missense probably damaging 1.00
R7171:Tmem94 UTSW 11 115790955 intron probably null
R7181:Tmem94 UTSW 11 115794774 missense probably damaging 0.97
R7290:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7292:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7345:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7346:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7378:Tmem94 UTSW 11 115794174 missense probably damaging 1.00
R7380:Tmem94 UTSW 11 115796145 critical splice donor site probably null
R7460:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7461:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7463:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7464:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7465:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7673:Tmem94 UTSW 11 115788378 missense probably benign 0.05
RF003:Tmem94 UTSW 11 115796132 missense probably damaging 1.00
X0024:Tmem94 UTSW 11 115786253 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TACCACTTGGAGATGCTGAGC -3'
(R):5'- GCACCTTGCCAGACTAGAAAG -3'

Sequencing Primer
(F):5'- ACTTGGAGATGCTGAGCCTGTC -3'
(R):5'- AGTGGCCAGTGCTCATAAC -3'
Posted On2018-07-24