Incidental Mutation 'R6698:Nif3l1'
ID 528633
Institutional Source Beutler Lab
Gene Symbol Nif3l1
Ensembl Gene ENSMUSG00000026036
Gene Name Ngg1 interacting factor 3-like 1 (S. pombe)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock # R6698 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 58445151-58481816 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58450489 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 179 (D179G)
Ref Sequence ENSEMBL: ENSMUSP00000109976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087521] [ENSMUST00000114337] [ENSMUST00000129759] [ENSMUST00000151272] [ENSMUST00000171597]
AlphaFold Q9EQ80
Predicted Effect probably benign
Transcript: ENSMUST00000087521
AA Change: D179G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000084799
Gene: ENSMUSG00000026036
AA Change: D179G

DomainStartEndE-ValueType
Pfam:NIF3 31 363 1.9e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114337
AA Change: D179G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000109976
Gene: ENSMUSG00000026036
AA Change: D179G

DomainStartEndE-ValueType
Pfam:NIF3 31 324 4e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129759
SMART Domains Protein: ENSMUSP00000124713
Gene: ENSMUSG00000026036

DomainStartEndE-ValueType
Pfam:NIF3 31 154 2e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140723
Predicted Effect probably benign
Transcript: ENSMUST00000151272
SMART Domains Protein: ENSMUSP00000123553
Gene: ENSMUSG00000026036

DomainStartEndE-ValueType
Pfam:NIF3 31 131 3.1e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171597
AA Change: D179G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000127501
Gene: ENSMUSG00000026036
AA Change: D179G

DomainStartEndE-ValueType
Pfam:NIF3 31 363 2.5e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185578
Meta Mutation Damage Score 0.0789 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: This gene is a member of the NGG1-interacting factor 3-like superfamily of transcriptional regulators and is ubiquitously expressed throughout embryonic development. The encoded protein interacts with a component of the constitutive photomorphogenesis 9 signalosome, and functions as a transcriptional corepressor of genes involved in neuronal differentiation. This gene is highly conserved from bacteria to human. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Park2 A G 17: 11,067,296 probably null Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Nif3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Nif3l1 APN 1 58455686 missense possibly damaging 0.56
IGL01657:Nif3l1 APN 1 58455612 missense probably damaging 0.98
IGL02159:Nif3l1 APN 1 58447946 splice site probably null
IGL02223:Nif3l1 APN 1 58448043 nonsense probably null
IGL02407:Nif3l1 APN 1 58457797 missense possibly damaging 0.87
IGL02435:Nif3l1 APN 1 58447861 missense possibly damaging 0.91
IGL02676:Nif3l1 APN 1 58455736 critical splice donor site probably null
IGL02721:Nif3l1 APN 1 58457849 missense probably damaging 1.00
R0472:Nif3l1 UTSW 1 58447828 missense probably damaging 1.00
R1036:Nif3l1 UTSW 1 58447873 missense probably damaging 1.00
R1256:Nif3l1 UTSW 1 58455649 missense probably damaging 0.99
R1439:Nif3l1 UTSW 1 58447943 missense probably damaging 1.00
R1483:Nif3l1 UTSW 1 58447726 missense probably benign 0.01
R2240:Nif3l1 UTSW 1 58452129 missense probably benign 0.35
R4379:Nif3l1 UTSW 1 58455579 intron probably benign
R4381:Nif3l1 UTSW 1 58455579 intron probably benign
R4552:Nif3l1 UTSW 1 58449324 unclassified probably benign
R6524:Nif3l1 UTSW 1 58457840 missense probably benign 0.01
R6567:Nif3l1 UTSW 1 58455630 missense probably benign 0.13
R7254:Nif3l1 UTSW 1 58450466 missense probably benign 0.01
R7841:Nif3l1 UTSW 1 58447883 missense probably damaging 1.00
R8358:Nif3l1 UTSW 1 58452129 missense probably benign 0.01
R8903:Nif3l1 UTSW 1 58447494 unclassified probably benign
R9057:Nif3l1 UTSW 1 58450489 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCATCTAAGGCGTATGTATGTATG -3'
(R):5'- GCAGGTAATAGCACGTGACTG -3'

Sequencing Primer
(F):5'- CATGAAAATGAGTTCTGAGACGTTTC -3'
(R):5'- AGGAGTAGTAGCTCACACCTGTTC -3'
Posted On 2018-07-24