Incidental Mutation 'R6698:Pnkd'
ID 528634
Institutional Source Beutler Lab
Gene Symbol Pnkd
Ensembl Gene ENSMUSG00000026179
Gene Name paroxysmal nonkinesiogenic dyskinesia
Synonyms 2810403H05Rik, Brp17, 2210013N15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R6698 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74284930-74353694 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74350677 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 320 (L320Q)
Ref Sequence ENSEMBL: ENSMUSP00000084478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027370] [ENSMUST00000087225] [ENSMUST00000087226]
AlphaFold Q69ZP3
Predicted Effect probably damaging
Transcript: ENSMUST00000027370
AA Change: L281Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027370
Gene: ENSMUSG00000026179
AA Change: L281Q

DomainStartEndE-ValueType
Blast:Lactamase_B 4 79 1e-24 BLAST
Lactamase_B 129 291 1.05e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087225
AA Change: L256Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084477
Gene: ENSMUSG00000026179
AA Change: L256Q

DomainStartEndE-ValueType
transmembrane domain 6 28 N/A INTRINSIC
transmembrane domain 49 68 N/A INTRINSIC
Lactamase_B 104 266 1.05e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087226
AA Change: L320Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084478
Gene: ENSMUSG00000026179
AA Change: L320Q

DomainStartEndE-ValueType
low complexity region 43 61 N/A INTRINSIC
Pfam:DUF4748 71 121 2.9e-23 PFAM
Lactamase_B 168 330 1.05e-31 SMART
Pfam:HAGH_C 331 421 6.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138620
Meta Mutation Damage Score 0.7952 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in the regulation of myofibrillogenesis. Mutations in this gene have been associated with the movement disorder paroxysmal non-kinesigenic dyskinesia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased levels of the dopamine metabolite 3,4-dihydroxyphenylacetic acid (DOPAC) and lower DOPAC/dopamine ratios after injection of caffeine or ethanol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Park2 A G 17: 11,067,296 probably null Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Pnkd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Pnkd APN 1 74285922 missense probably damaging 1.00
IGL01322:Pnkd APN 1 74351557 missense probably damaging 1.00
IGL02536:Pnkd APN 1 74351900 missense probably damaging 1.00
IGL02712:Pnkd APN 1 74349868 missense possibly damaging 0.62
R0731:Pnkd UTSW 1 74351541 missense probably damaging 1.00
R0741:Pnkd UTSW 1 74351859 missense possibly damaging 0.56
R1483:Pnkd UTSW 1 74349391 missense probably benign 0.08
R1497:Pnkd UTSW 1 74351522 splice site probably null
R1515:Pnkd UTSW 1 74349809 missense probably null 1.00
R1759:Pnkd UTSW 1 74348763 missense probably damaging 0.98
R1969:Pnkd UTSW 1 74351849 missense probably damaging 0.97
R1970:Pnkd UTSW 1 74285910 splice site probably null
R3508:Pnkd UTSW 1 74350634 missense probably benign 0.01
R4714:Pnkd UTSW 1 74351782 missense probably damaging 1.00
R4811:Pnkd UTSW 1 74349405 splice site probably null
R5437:Pnkd UTSW 1 74349737 missense possibly damaging 0.61
R5931:Pnkd UTSW 1 74350674 missense probably benign
R6994:Pnkd UTSW 1 74293176 splice site probably null
R9124:Pnkd UTSW 1 74347443 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGAGTAACTGGGCTGAGCTC -3'
(R):5'- AGGCATGGACATCACACAG -3'

Sequencing Primer
(F):5'- GCTGAGCTCCCATGAAGAG -3'
(R):5'- AGTCTAACGTCCCAGGAGG -3'
Posted On 2018-07-24