Incidental Mutation 'R6698:Flvcr1'
ID 528635
Institutional Source Beutler Lab
Gene Symbol Flvcr1
Ensembl Gene ENSMUSG00000066595
Gene Name feline leukemia virus subgroup C cellular receptor 1
Synonyms Mfsd7b, 9630055N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6698 (G1)
Quality Score 145.008
Status Validated
Chromosome 1
Chromosomal Location 191005847-191026158 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 191025732 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 79 (Y79C)
Ref Sequence ENSEMBL: ENSMUSP00000141985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085635] [ENSMUST00000191946] [ENSMUST00000192666]
AlphaFold B2RXV4
Predicted Effect probably damaging
Transcript: ENSMUST00000085635
AA Change: Y121C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082777
Gene: ENSMUSG00000066595
AA Change: Y121C

DomainStartEndE-ValueType
low complexity region 40 68 N/A INTRINSIC
Pfam:MFS_1 100 483 1.5e-28 PFAM
transmembrane domain 498 517 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181050
SMART Domains Protein: ENSMUSP00000138069
Gene: ENSMUSG00000097845

DomainStartEndE-ValueType
low complexity region 97 106 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 246 265 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191946
AA Change: Y121C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141578
Gene: ENSMUSG00000066595
AA Change: Y121C

DomainStartEndE-ValueType
low complexity region 40 68 N/A INTRINSIC
Pfam:MFS_1 96 243 2.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192407
Predicted Effect probably damaging
Transcript: ENSMUST00000192666
AA Change: Y79C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141985
Gene: ENSMUSG00000066595
AA Change: Y79C

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:MFS_1 54 198 3.1e-9 PFAM
Meta Mutation Damage Score 0.5217 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the major facilitator superfamily of transporter proteins. The encoded protein is a heme transporter that may play a critical role in erythropoiesis by protecting developing erythroid cells from heme toxicity. This gene may play a role in posterior column ataxia with retinitis pigmentosa and the hematological disorder Diamond-Blackfan syndrome. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit runting, cardiomegaly and splenomegaly, lack definitive erythropoiesis, develop severe hyperchromic macrocytic anemia and reticulocytopenia, and show craniofacial and limb defects and intrauterine lethality modulated by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Park2 A G 17: 11,067,296 probably null Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Flvcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Flvcr1 APN 1 191015489 nonsense probably null
IGL01089:Flvcr1 APN 1 191013390 missense probably damaging 0.98
IGL02572:Flvcr1 APN 1 191025646 missense probably damaging 1.00
IGL03248:Flvcr1 APN 1 191025742 missense probably damaging 1.00
R0009:Flvcr1 UTSW 1 191008191 missense probably benign
R0122:Flvcr1 UTSW 1 191021226 missense possibly damaging 0.79
R0363:Flvcr1 UTSW 1 191012254 splice site probably benign
R0417:Flvcr1 UTSW 1 191011219 missense probably benign 0.05
R0718:Flvcr1 UTSW 1 191025582 missense probably damaging 1.00
R1061:Flvcr1 UTSW 1 191008173 missense probably benign 0.01
R1815:Flvcr1 UTSW 1 191025380 missense probably damaging 1.00
R2029:Flvcr1 UTSW 1 191021156 missense probably benign 0.01
R4590:Flvcr1 UTSW 1 191012146 missense probably benign 0.05
R4766:Flvcr1 UTSW 1 191021106 missense probably benign 0.00
R4889:Flvcr1 UTSW 1 191025567 missense probably damaging 1.00
R4976:Flvcr1 UTSW 1 191025495 missense probably damaging 1.00
R5434:Flvcr1 UTSW 1 191026009 missense probably benign 0.07
R5508:Flvcr1 UTSW 1 191025459 missense probably damaging 1.00
R5930:Flvcr1 UTSW 1 191009551 missense probably damaging 1.00
R6927:Flvcr1 UTSW 1 191025664 missense possibly damaging 0.66
R7544:Flvcr1 UTSW 1 191025946 missense probably damaging 0.99
R7654:Flvcr1 UTSW 1 191011605 missense possibly damaging 0.83
R7853:Flvcr1 UTSW 1 191025646 missense probably damaging 1.00
R8387:Flvcr1 UTSW 1 191011534 critical splice donor site probably null
R8995:Flvcr1 UTSW 1 191011620 missense probably damaging 1.00
R9092:Flvcr1 UTSW 1 191008167 missense
R9202:Flvcr1 UTSW 1 191012154 missense probably benign 0.04
R9448:Flvcr1 UTSW 1 191012209 missense possibly damaging 0.65
X0064:Flvcr1 UTSW 1 191025447 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTTACCTGATTGCCCAGCACTG -3'
(R):5'- ATACCTTCCAGTGCCCAAGG -3'

Sequencing Primer
(F):5'- AGCACTGCTGTGGCACAAG -3'
(R):5'- GCTTGGTACCGCAAAACG -3'
Posted On 2018-07-24