Incidental Mutation 'R6698:Olfr1165-ps'
ID 528638
Institutional Source Beutler Lab
Gene Symbol Olfr1165-ps
Ensembl Gene ENSMUSG00000046590
Gene Name olfactory receptor 1165, pseudogene
Synonyms GA_x6K02T2Q125-49593880-49592930, MOR174-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R6698 (G1)
Quality Score 129.008
Status Validated
Chromosome 2
Chromosomal Location 88101036-88101985 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88101217 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 257 (F257L)
Ref Sequence ENSEMBL: ENSMUSP00000149054 (fasta)
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000117860
AA Change: F257L
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Park2 A G 17: 11,067,296 probably null Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Olfr1165-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4378:Olfr1165-ps UTSW 2 88101485 missense unknown
R5078:Olfr1165-ps UTSW 2 88101535 missense probably benign 0.03
R6373:Olfr1165-ps UTSW 2 88101845 missense possibly damaging 0.73
R6736:Olfr1165-ps UTSW 2 88101603 missense probably benign 0.03
R7164:Olfr1165-ps UTSW 2 88101832 missense probably damaging 0.97
R7285:Olfr1165-ps UTSW 2 88101705 missense probably damaging 1.00
R7807:Olfr1165-ps UTSW 2 88101565 missense probably benign 0.00
R8040:Olfr1165-ps UTSW 2 88101359 missense unknown
R8509:Olfr1165-ps UTSW 2 88101522 missense probably benign 0.16
R9047:Olfr1165-ps UTSW 2 88101072 missense unknown
Predicted Primers PCR Primer
(F):5'- GTGAAAAGCAGTATACATTCAAGGC -3'
(R):5'- TCAGCCAAGTGGTATGTTTAACC -3'

Sequencing Primer
(F):5'- AGCAGTATACATTCAAGGCAAATG -3'
(R):5'- GCCAAGTGGTATGTTTAACCATTTC -3'
Posted On 2018-07-24