Mutagenetix > Incidental Mutations

Incidental Mutation 'R6698:Rpn2'

528640

Institutional Source

Beutler Lab

Gene Symbol

Rpn2

Ensembl Gene

ENSMUSG00000027642

Gene Name

ribophorin II

Synonyms

Rpn-2, 1300012C06Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6698 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

157279017-157326319 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 157297410 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 208 (I208T)

Ref Sequence

ENSEMBL: ENSMUSP00000029171 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029171] [ENSMUST00000116380]

AlphaFold

Q9DBG6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029171
AA Change: I208T

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000029171
Gene: ENSMUSG00000027642
AA Change: I208T

Domain	Start	End	E-Value	Type
Pfam:Ribophorin_II	2	71	1.5e-15	PFAM
Pfam:Ribophorin_II	68	596	3.5e-247	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000116380
AA Change: I240T

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000112081
Gene: ENSMUSG00000027642
AA Change: I240T

Domain	Start	End	E-Value	Type
Pfam:Ribophorin_II	9	627	1.8e-223	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125311

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126248

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127252

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein is similar in sequence to the yeast oligosaccharyl transferase subunit SWP1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Brca2	T	C	5: 150,532,394	V200A	probably damaging	Het
Camk2g	T	A	14: 20,742,708	K393*	probably null	Het
Catsperb	T	A	12: 101,509,207	F337I	probably damaging	Het
Cdk17	T	C	10: 93,228,678	Y270H	probably damaging	Het
Col5a3	C	T	9: 20,779,033	G1162R	probably damaging	Het
Col6a5	T	A	9: 105,934,175	N715I	unknown	Het
Fam198b	A	G	3: 79,936,595	I10V	probably damaging	Het
Fancg	A	G	4: 43,007,034	S248P	probably benign	Het
Flvcr1	T	C	1: 191,025,732	Y79C	probably damaging	Het
Gabrp	A	G	11: 33,557,017	S198P	probably damaging	Het
Glp1r	A	G	17: 30,936,401	Y454C	probably damaging	Het
Gpr158	A	C	2: 21,827,110	D1007A	probably damaging	Het
Gsdmc3	A	G	15: 63,860,271	F302S	possibly damaging	Het
Gsdmc4	T	A	15: 63,893,764	D312V	probably benign	Het
Itga5	T	C	15: 103,351,381	Y663C	probably benign	Het
Kif1b	A	T	4: 149,274,956	M108K	probably damaging	Het
Klf11	T	G	12: 24,653,619	S18A	probably damaging	Het
Lmtk2	T	C	5: 144,174,919	V819A	probably benign	Het
Lrba	A	G	3: 86,304,425	M451V	probably damaging	Het
Lrp1b	T	C	2: 41,302,946	D488G	probably damaging	Het
Mark4	T	C	7: 19,429,437	N589S	probably benign	Het
Mis12	T	C	11: 71,025,186	F15S	probably damaging	Het
Nif3l1	A	G	1: 58,450,489	D179G	probably benign	Het
Nlrx1	A	G	9: 44,265,807	W3R	probably damaging	Het
Nup210l	G	A	3: 90,182,508	S1194N	possibly damaging	Het
Olfr1165-ps	A	G	2: 88,101,217	F257L	unknown	Het
Olfr451-ps1	A	T	6: 42,801,202	T154S	probably benign	Het
Park2	A	G	17: 11,067,296		probably null	Het
Pnkd	T	A	1: 74,350,677	L320Q	probably damaging	Het
Rcc2	G	A	4: 140,702,275	C40Y	probably benign	Homo
Rilpl2	C	T	5: 124,469,780	E126K	probably damaging	Het
Skint4	G	T	4: 112,119,899	C170F	probably damaging	Het
Synj1	C	G	16: 90,960,452	V877L	probably damaging	Het
Tcp11	A	T	17: 28,071,830	I106N	possibly damaging	Het
Tg	A	G	15: 66,839,362	Y991C	probably damaging	Het
Trib3	A	G	2: 152,338,419	S285P	probably damaging	Het
Wdr49	A	T	3: 75,429,366	W345R	probably benign	Het
Wnt5a	A	G	14: 28,518,463	Y190C	possibly damaging	Het
Xpo1	A	G	11: 23,294,040	E955G	probably benign	Het

Other mutations in Rpn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Rpn2	APN	2	157314913	missense	probably damaging	1.00
IGL01894:Rpn2	APN	2	157294173	missense	probably benign	0.45
IGL02104:Rpn2	APN	2	157321827	missense	probably damaging	1.00
IGL02368:Rpn2	APN	2	157302408	missense	probably benign
IGL02819:Rpn2	APN	2	157316210	critical splice donor site	probably null
R0932:Rpn2	UTSW	2	157283771	missense	possibly damaging	0.66
R1666:Rpn2	UTSW	2	157294155	missense	possibly damaging	0.93
R1668:Rpn2	UTSW	2	157294155	missense	possibly damaging	0.93
R1713:Rpn2	UTSW	2	157314968	missense	probably damaging	0.99
R2276:Rpn2	UTSW	2	157310288	missense	possibly damaging	0.64
R2279:Rpn2	UTSW	2	157310288	missense	possibly damaging	0.64
R3409:Rpn2	UTSW	2	157290652	missense	possibly damaging	0.91
R3411:Rpn2	UTSW	2	157290652	missense	possibly damaging	0.91
R3777:Rpn2	UTSW	2	157299557	missense	probably damaging	0.99
R4004:Rpn2	UTSW	2	157318008	missense	probably damaging	1.00
R4575:Rpn2	UTSW	2	157295324	missense	probably damaging	1.00
R4613:Rpn2	UTSW	2	157302425	missense	possibly damaging	0.87
R4856:Rpn2	UTSW	2	157318044	critical splice donor site	probably null
R4886:Rpn2	UTSW	2	157318044	critical splice donor site	probably null
R5491:Rpn2	UTSW	2	157297383	missense	probably damaging	0.99
R5526:Rpn2	UTSW	2	157323267	missense	probably damaging	1.00
R5633:Rpn2	UTSW	2	157283596	missense	possibly damaging	0.81
R5718:Rpn2	UTSW	2	157321827	missense	probably damaging	1.00
R5772:Rpn2	UTSW	2	157295345	missense	probably damaging	1.00
R6101:Rpn2	UTSW	2	157310188	splice site	probably null
R6618:Rpn2	UTSW	2	157321861	missense	probably benign
R8882:Rpn2	UTSW	2	157294182	missense	probably benign
R8953:Rpn2	UTSW	2	157321826	missense	probably damaging	1.00
R9085:Rpn2	UTSW	2	157283647	missense	possibly damaging	0.49
R9124:Rpn2	UTSW	2	157297538	missense	probably benign
R9368:Rpn2	UTSW	2	157299580	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TAGCTCAGTAGTTCCCTGGC -3'
(R):5'- GGTTGCCGTATACCACATCTC -3'

Sequencing Primer
(F):5'- AGCTCAGTAGTTCCCTGGCATTTG -3'
(R):5'- AGTCTAGCTCTAGAAAAAGCCTG -3'

Posted On

2018-07-24