Incidental Mutation 'R6698:Rpn2'
ID 528640
Institutional Source Beutler Lab
Gene Symbol Rpn2
Ensembl Gene ENSMUSG00000027642
Gene Name ribophorin II
Synonyms Rpn-2, 1300012C06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6698 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 157279017-157326319 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 157297410 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 208 (I208T)
Ref Sequence ENSEMBL: ENSMUSP00000029171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029171] [ENSMUST00000116380]
AlphaFold Q9DBG6
Predicted Effect possibly damaging
Transcript: ENSMUST00000029171
AA Change: I208T

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029171
Gene: ENSMUSG00000027642
AA Change: I208T

DomainStartEndE-ValueType
Pfam:Ribophorin_II 2 71 1.5e-15 PFAM
Pfam:Ribophorin_II 68 596 3.5e-247 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116380
AA Change: I240T

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112081
Gene: ENSMUSG00000027642
AA Change: I240T

DomainStartEndE-ValueType
Pfam:Ribophorin_II 9 627 1.8e-223 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127252
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein is similar in sequence to the yeast oligosaccharyl transferase subunit SWP1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Park2 A G 17: 11,067,296 probably null Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Rpn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Rpn2 APN 2 157314913 missense probably damaging 1.00
IGL01894:Rpn2 APN 2 157294173 missense probably benign 0.45
IGL02104:Rpn2 APN 2 157321827 missense probably damaging 1.00
IGL02368:Rpn2 APN 2 157302408 missense probably benign
IGL02819:Rpn2 APN 2 157316210 critical splice donor site probably null
R0932:Rpn2 UTSW 2 157283771 missense possibly damaging 0.66
R1666:Rpn2 UTSW 2 157294155 missense possibly damaging 0.93
R1668:Rpn2 UTSW 2 157294155 missense possibly damaging 0.93
R1713:Rpn2 UTSW 2 157314968 missense probably damaging 0.99
R2276:Rpn2 UTSW 2 157310288 missense possibly damaging 0.64
R2279:Rpn2 UTSW 2 157310288 missense possibly damaging 0.64
R3409:Rpn2 UTSW 2 157290652 missense possibly damaging 0.91
R3411:Rpn2 UTSW 2 157290652 missense possibly damaging 0.91
R3777:Rpn2 UTSW 2 157299557 missense probably damaging 0.99
R4004:Rpn2 UTSW 2 157318008 missense probably damaging 1.00
R4575:Rpn2 UTSW 2 157295324 missense probably damaging 1.00
R4613:Rpn2 UTSW 2 157302425 missense possibly damaging 0.87
R4856:Rpn2 UTSW 2 157318044 critical splice donor site probably null
R4886:Rpn2 UTSW 2 157318044 critical splice donor site probably null
R5491:Rpn2 UTSW 2 157297383 missense probably damaging 0.99
R5526:Rpn2 UTSW 2 157323267 missense probably damaging 1.00
R5633:Rpn2 UTSW 2 157283596 missense possibly damaging 0.81
R5718:Rpn2 UTSW 2 157321827 missense probably damaging 1.00
R5772:Rpn2 UTSW 2 157295345 missense probably damaging 1.00
R6101:Rpn2 UTSW 2 157310188 splice site probably null
R6618:Rpn2 UTSW 2 157321861 missense probably benign
R8882:Rpn2 UTSW 2 157294182 missense probably benign
R8953:Rpn2 UTSW 2 157321826 missense probably damaging 1.00
R9085:Rpn2 UTSW 2 157283647 missense possibly damaging 0.49
R9124:Rpn2 UTSW 2 157297538 missense probably benign
R9368:Rpn2 UTSW 2 157299580 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TAGCTCAGTAGTTCCCTGGC -3'
(R):5'- GGTTGCCGTATACCACATCTC -3'

Sequencing Primer
(F):5'- AGCTCAGTAGTTCCCTGGCATTTG -3'
(R):5'- AGTCTAGCTCTAGAAAAAGCCTG -3'
Posted On 2018-07-24