Incidental Mutation 'R6698:Wdr49'
ID 528641
Institutional Source Beutler Lab
Gene Symbol Wdr49
Ensembl Gene ENSMUSG00000104301
Gene Name WD repeat domain 49
Synonyms EG213248
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R6698 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 75274988-75482156 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 75429366 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 345 (W345R)
Ref Sequence ENSEMBL: ENSMUSP00000145379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000193989] [ENSMUST00000203169] [ENSMUST00000204341]
AlphaFold A0A0N4SUK7
Predicted Effect probably benign
Transcript: ENSMUST00000193989
AA Change: W67R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000144721
Gene: ENSMUSG00000104301
AA Change: W67R

DomainStartEndE-ValueType
WD40 17 55 1.3e-2 SMART
WD40 59 98 2e-6 SMART
WD40 145 184 2.5e-2 SMART
WD40 187 228 3.6e-8 SMART
WD40 281 318 8.7e-6 SMART
WD40 365 412 2.2e-1 SMART
WD40 415 455 8.4e-4 SMART
WD40 471 512 3.1e-2 SMART
Blast:SERPIN 608 673 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000203169
AA Change: W408R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144789
Gene: ENSMUSG00000104301
AA Change: W408R

DomainStartEndE-ValueType
WD40 136 176 2e-1 SMART
WD40 178 224 1.8e0 SMART
WD40 312 353 5.1e-1 SMART
WD40 358 396 1.3e-2 SMART
WD40 400 439 2e-6 SMART
Blast:WD40 486 511 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000204341
AA Change: W345R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000145379
Gene: ENSMUSG00000104301
AA Change: W345R

DomainStartEndE-ValueType
WD40 73 113 3.18e1 SMART
WD40 115 161 2.74e2 SMART
WD40 249 290 7.92e1 SMART
WD40 295 333 1.99e0 SMART
WD40 337 376 3.05e-4 SMART
Blast:WD40 423 448 1e-7 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family with nine WD repeats. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Park2 A G 17: 11,067,296 probably null Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Wdr49
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0266:Wdr49 UTSW 3 75451796 missense possibly damaging 0.80
R0432:Wdr49 UTSW 3 75450022 missense possibly damaging 0.70
R0599:Wdr49 UTSW 3 75431076 splice site probably null
R0599:Wdr49 UTSW 3 75449890 splice site probably null
R0948:Wdr49 UTSW 3 75450851 missense probably benign 0.06
R1341:Wdr49 UTSW 3 75429333 missense probably damaging 1.00
R1526:Wdr49 UTSW 3 75396920 missense probably benign 0.03
R1593:Wdr49 UTSW 3 75396941 missense probably benign 0.00
R1603:Wdr49 UTSW 3 75396870 nonsense probably null
R1874:Wdr49 UTSW 3 75429347 missense probably damaging 1.00
R2986:Wdr49 UTSW 3 75382040 missense probably benign 0.11
R3013:Wdr49 UTSW 3 75450847 missense probably damaging 0.96
R3025:Wdr49 UTSW 3 75333356 missense possibly damaging 0.94
R4027:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4029:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4030:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4031:Wdr49 UTSW 3 75323665 missense probably benign 0.05
R4578:Wdr49 UTSW 3 75335243 missense probably benign 0.00
R6024:Wdr49 UTSW 3 75301826 missense probably benign 0.02
R6141:Wdr49 UTSW 3 75323682 missense probably benign
R6172:Wdr49 UTSW 3 75298180 missense probably damaging 1.00
R6263:Wdr49 UTSW 3 75481517 missense possibly damaging 0.84
R6501:Wdr49 UTSW 3 75339458 missense probably benign 0.01
R6584:Wdr49 UTSW 3 75337758 missense probably benign 0.01
R6891:Wdr49 UTSW 3 75333283 splice site probably null
R7202:Wdr49 UTSW 3 75333273 missense probably benign 0.11
R7214:Wdr49 UTSW 3 75358444 missense possibly damaging 0.63
R7572:Wdr49 UTSW 3 75358437 missense possibly damaging 0.94
R7575:Wdr49 UTSW 3 75450886 missense probably damaging 0.96
R7673:Wdr49 UTSW 3 75450907 missense probably damaging 1.00
R7790:Wdr49 UTSW 3 75275028 missense probably benign 0.16
R7958:Wdr49 UTSW 3 75431147 missense probably benign 0.08
R8444:Wdr49 UTSW 3 75451690 missense probably benign 0.00
R9183:Wdr49 UTSW 3 75298112 missense probably benign 0.08
R9213:Wdr49 UTSW 3 75298112 missense probably benign 0.08
R9374:Wdr49 UTSW 3 75323624 missense probably benign
R9492:Wdr49 UTSW 3 75333362 missense probably damaging 1.00
R9552:Wdr49 UTSW 3 75323624 missense probably benign
R9595:Wdr49 UTSW 3 75358440 missense probably damaging 1.00
Z1176:Wdr49 UTSW 3 75451533 missense probably damaging 1.00
Z1177:Wdr49 UTSW 3 75449903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGAACAAGTGATATCTCTCAGAG -3'
(R):5'- CTAGTTGGGCAATGCTAGGG -3'

Sequencing Primer
(F):5'- ATCTCTCAGAGAAATCTGGGGTCC -3'
(R):5'- TAAGATGGGGATACTAGTGTTCACC -3'
Posted On 2018-07-24