Incidental Mutation 'R6698:Fam198b'
ID 528642
Institutional Source Beutler Lab
Gene Symbol Fam198b
Ensembl Gene ENSMUSG00000027955
Gene Name family with sequence similarity 198, member B
Synonyms 2210419I08Rik, 1110032E23Rik, Ened
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_133187.3; MGI:1915909

Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R6698 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 79884533-79946280 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79936595 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 10 (I10V)
Ref Sequence ENSEMBL: ENSMUSP00000120603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029567] [ENSMUST00000118853] [ENSMUST00000145992]
AlphaFold Q3UPI1
Predicted Effect possibly damaging
Transcript: ENSMUST00000029567
AA Change: I374V

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029567
Gene: ENSMUSG00000027955
AA Change: I374V

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
Pfam:FAM198 202 516 9.1e-156 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118853
AA Change: I374V

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114093
Gene: ENSMUSG00000027955
AA Change: I374V

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
Pfam:FAM198 202 516 1.1e-155 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145992
AA Change: I10V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120603
Gene: ENSMUSG00000027955
AA Change: I10V

DomainStartEndE-ValueType
Pfam:FAM198 1 51 5.4e-27 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Park2 A G 17: 11,067,296 probably null Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Fam198b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02952:Fam198b APN 3 79886339 missense probably damaging 1.00
P0015:Fam198b UTSW 3 79936608 missense probably damaging 1.00
PIT4362001:Fam198b UTSW 3 79886939 missense possibly damaging 0.78
R1519:Fam198b UTSW 3 79941464 missense possibly damaging 0.88
R1723:Fam198b UTSW 3 79936663 missense probably benign
R1782:Fam198b UTSW 3 79886531 missense possibly damaging 0.85
R3040:Fam198b UTSW 3 79887125 missense possibly damaging 0.95
R3840:Fam198b UTSW 3 79908590 missense probably benign 0.32
R4841:Fam198b UTSW 3 79936605 missense probably damaging 1.00
R4842:Fam198b UTSW 3 79936605 missense probably damaging 1.00
R4860:Fam198b UTSW 3 79936674 nonsense probably null
R4860:Fam198b UTSW 3 79936674 nonsense probably null
R5181:Fam198b UTSW 3 79886311 missense probably benign 0.08
R5266:Fam198b UTSW 3 79936603 missense probably damaging 0.96
R6353:Fam198b UTSW 3 79941340 missense probably damaging 1.00
R6856:Fam198b UTSW 3 79886141 intron probably benign
R6927:Fam198b UTSW 3 79941462 missense probably damaging 1.00
R7025:Fam198b UTSW 3 79886548 missense probably damaging 1.00
R7189:Fam198b UTSW 3 79886807 nonsense probably null
R7434:Fam198b UTSW 3 79941362 missense probably damaging 1.00
R7557:Fam198b UTSW 3 79886608 nonsense probably null
R7780:Fam198b UTSW 3 79941404 missense probably damaging 1.00
R7891:Fam198b UTSW 3 79886284 missense probably benign 0.00
R8812:Fam198b UTSW 3 79908771 missense possibly damaging 0.82
R8841:Fam198b UTSW 3 79887119 missense probably benign 0.08
R8960:Fam198b UTSW 3 79886986 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGGGCTTTGAACTACGGAC -3'
(R):5'- TCGGATGCCTTCTAACAACTTAAAG -3'

Sequencing Primer
(F):5'- ACGGACTTATTCTAGCAGCTG -3'
(R):5'- CACAGAAGTTTGGTCCTC -3'
Posted On 2018-07-24