Mutagenetix > Incidental Mutation

Incidental Mutation 'R6698:Skint4'

528646

Institutional Source

Beutler Lab

Gene Symbol

Skint4

Ensembl Gene

ENSMUSG00000055960

Gene Name

selection and upkeep of intraepithelial T cells 4

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R6698 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

112072016-112168076 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 112119899 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 170 (C170F)

Ref Sequence

ENSEMBL: ENSMUSP00000102176 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069769] [ENSMUST00000106564] [ENSMUST00000106565] [ENSMUST00000106566]

AlphaFold

A7TZF3

Predicted Effect

probably damaging
Transcript: ENSMUST00000069769
AA Change: C162F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000070676
Gene: ENSMUSG00000055960
AA Change: C162F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG	33	140	7.24e-10	SMART
Pfam:C2-set_2	141	227	6.2e-8	PFAM
transmembrane domain	242	264	N/A	INTRINSIC
transmembrane domain	296	318	N/A	INTRINSIC
transmembrane domain	342	364	N/A	INTRINSIC
transmembrane domain	383	405	N/A	INTRINSIC
transmembrane domain	425	447	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106564
AA Change: C162F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102174
Gene: ENSMUSG00000055960
AA Change: C162F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG	33	140	7.24e-10	SMART
Pfam:C2-set_2	141	227	6.2e-8	PFAM
transmembrane domain	242	264	N/A	INTRINSIC
transmembrane domain	296	318	N/A	INTRINSIC
transmembrane domain	342	364	N/A	INTRINSIC
transmembrane domain	383	405	N/A	INTRINSIC
transmembrane domain	425	447	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106565
AA Change: C162F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102175
Gene: ENSMUSG00000055960
AA Change: C162F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG	33	140	7.24e-10	SMART
Pfam:C2-set_2	141	227	6.2e-8	PFAM
transmembrane domain	242	264	N/A	INTRINSIC
transmembrane domain	296	318	N/A	INTRINSIC
transmembrane domain	342	364	N/A	INTRINSIC
transmembrane domain	383	405	N/A	INTRINSIC
transmembrane domain	425	447	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106566
AA Change: C170F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102176
Gene: ENSMUSG00000055960
AA Change: C170F

Domain	Start	End	E-Value	Type
IG	41	148	7.24e-10	SMART
transmembrane domain	250	272	N/A	INTRINSIC
transmembrane domain	304	326	N/A	INTRINSIC
transmembrane domain	350	372	N/A	INTRINSIC
transmembrane domain	391	413	N/A	INTRINSIC
transmembrane domain	433	455	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119233

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

95% (40/42)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Brca2	T	C	5: 150,532,394	V200A	probably damaging	Het
Camk2g	T	A	14: 20,742,708	K393*	probably null	Het
Catsperb	T	A	12: 101,509,207	F337I	probably damaging	Het
Cdk17	T	C	10: 93,228,678	Y270H	probably damaging	Het
Col5a3	C	T	9: 20,779,033	G1162R	probably damaging	Het
Col6a5	T	A	9: 105,934,175	N715I	unknown	Het
Fam198b	A	G	3: 79,936,595	I10V	probably damaging	Het
Fancg	A	G	4: 43,007,034	S248P	probably benign	Het
Flvcr1	T	C	1: 191,025,732	Y79C	probably damaging	Het
Gabrp	A	G	11: 33,557,017	S198P	probably damaging	Het
Glp1r	A	G	17: 30,936,401	Y454C	probably damaging	Het
Gpr158	A	C	2: 21,827,110	D1007A	probably damaging	Het
Gsdmc3	A	G	15: 63,860,271	F302S	possibly damaging	Het
Gsdmc4	T	A	15: 63,893,764	D312V	probably benign	Het
Itga5	T	C	15: 103,351,381	Y663C	probably benign	Het
Kif1b	A	T	4: 149,274,956	M108K	probably damaging	Het
Klf11	T	G	12: 24,653,619	S18A	probably damaging	Het
Lmtk2	T	C	5: 144,174,919	V819A	probably benign	Het
Lrba	A	G	3: 86,304,425	M451V	probably damaging	Het
Lrp1b	T	C	2: 41,302,946	D488G	probably damaging	Het
Mark4	T	C	7: 19,429,437	N589S	probably benign	Het
Mis12	T	C	11: 71,025,186	F15S	probably damaging	Het
Nif3l1	A	G	1: 58,450,489	D179G	probably benign	Het
Nlrx1	A	G	9: 44,265,807	W3R	probably damaging	Het
Nup210l	G	A	3: 90,182,508	S1194N	possibly damaging	Het
Olfr1165-ps	A	G	2: 88,101,217	F257L	unknown	Het
Olfr451-ps1	A	T	6: 42,801,202	T154S	probably benign	Het
Park2	A	G	17: 11,067,296		probably null	Het
Pnkd	T	A	1: 74,350,677	L320Q	probably damaging	Het
Rcc2	G	A	4: 140,702,275	C40Y	probably benign	Homo
Rilpl2	C	T	5: 124,469,780	E126K	probably damaging	Het
Rpn2	T	C	2: 157,297,410	I208T	possibly damaging	Het
Synj1	C	G	16: 90,960,452	V877L	probably damaging	Het
Tcp11	A	T	17: 28,071,830	I106N	possibly damaging	Het
Tg	A	G	15: 66,839,362	Y991C	probably damaging	Het
Trib3	A	G	2: 152,338,419	S285P	probably damaging	Het
Wdr49	A	T	3: 75,429,366	W345R	probably benign	Het
Wnt5a	A	G	14: 28,518,463	Y190C	possibly damaging	Het
Xpo1	A	G	11: 23,294,040	E955G	probably benign	Het

Other mutations in Skint4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01397:Skint4	APN	4	112120010	missense	possibly damaging	0.86
IGL01654:Skint4	APN	4	112120057	missense	probably damaging	0.99
IGL02040:Skint4	APN	4	112146482	splice site	probably benign
IGL02328:Skint4	APN	4	112120058	missense	possibly damaging	0.92
IGL02811:Skint4	APN	4	112087003	missense	possibly damaging	0.86
IGL02965:Skint4	APN	4	112136021	missense	probably benign	0.01
IGL03039:Skint4	APN	4	112124650	missense	probably benign	0.20
IGL03060:Skint4	APN	4	112118235	missense	probably benign	0.33
IGL03075:Skint4	APN	4	112087042	missense	probably damaging	1.00
IGL03352:Skint4	APN	4	112165686	missense	possibly damaging	0.96
PIT4378001:Skint4	UTSW	4	112087035	missense	probably benign	0.01
R0483:Skint4	UTSW	4	112117939	splice site	probably benign
R1175:Skint4	UTSW	4	112124596	missense	probably benign	0.14
R1446:Skint4	UTSW	4	112118114	missense	probably benign	0.11
R1641:Skint4	UTSW	4	112136043	missense	possibly damaging	0.93
R1983:Skint4	UTSW	4	112146492	missense	probably benign	0.00
R2168:Skint4	UTSW	4	112086986	critical splice acceptor site	probably null
R2272:Skint4	UTSW	4	112119868	missense	probably benign	0.01
R2287:Skint4	UTSW	4	112118205	missense	possibly damaging	0.70
R3801:Skint4	UTSW	4	112118181	missense	probably damaging	0.98
R3802:Skint4	UTSW	4	112118181	missense	probably damaging	0.98
R3804:Skint4	UTSW	4	112118181	missense	probably damaging	0.98
R4009:Skint4	UTSW	4	112120109	missense	possibly damaging	0.70
R4050:Skint4	UTSW	4	112124614	missense	probably benign	0.01
R4564:Skint4	UTSW	4	112119869	missense	probably damaging	0.99
R4581:Skint4	UTSW	4	112087042	missense	probably damaging	1.00
R4587:Skint4	UTSW	4	112087024	missense	probably damaging	0.99
R4674:Skint4	UTSW	4	112118233	missense	probably damaging	1.00
R4723:Skint4	UTSW	4	112118236	missense	possibly damaging	0.70
R4753:Skint4	UTSW	4	112146531	missense	probably benign	0.00
R4775:Skint4	UTSW	4	112136064	missense	probably damaging	0.97
R4832:Skint4	UTSW	4	112143766	missense	possibly damaging	0.49
R5299:Skint4	UTSW	4	112136006	missense	possibly damaging	0.59
R6118:Skint4	UTSW	4	112119822	splice site	probably null
R6433:Skint4	UTSW	4	112146510	missense	probably benign	0.00
R6616:Skint4	UTSW	4	112118230	missense	possibly damaging	0.70
R6752:Skint4	UTSW	4	112119863	missense	possibly damaging	0.89
R7034:Skint4	UTSW	4	112158084	missense	possibly damaging	0.53
R7102:Skint4	UTSW	4	112118101	missense	probably damaging	1.00
R7602:Skint4	UTSW	4	112118271	missense	possibly damaging	0.50
R8027:Skint4	UTSW	4	112157985	critical splice acceptor site	probably null
R8038:Skint4	UTSW	4	112119806	intron	probably benign
R8147:Skint4	UTSW	4	112136021	missense	probably benign	0.06
R8375:Skint4	UTSW	4	112117976	missense	probably damaging	0.98
R8682:Skint4	UTSW	4	112136040	missense	possibly damaging	0.86
R8695:Skint4	UTSW	4	112118067	missense	probably damaging	1.00
R9068:Skint4	UTSW	4	112165735	missense	possibly damaging	0.93
R9361:Skint4	UTSW	4	112143824	missense	probably damaging	0.99
R9516:Skint4	UTSW	4	112158039	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- CAATGTGCATCCTATGTGTTTTGAC -3'
(R):5'- CTCCACTAAGTGATGAGTAAGGC -3'

Sequencing Primer
(F):5'- CTGGAATTATAACTGGAAA -3'
(R):5'- GTGAGTTACAAGGTTTTGAAAGTAGC -3'

Posted On

2018-07-24