Incidental Mutation 'R6698:Rcc2'
ID 528647
Institutional Source Beutler Lab
Gene Symbol Rcc2
Ensembl Gene ENSMUSG00000040945
Gene Name regulator of chromosome condensation 2
Synonyms Td60, 2610529N02Rik, 2610510H01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6698 (G1)
Quality Score 96.5136
Status Not validated
Chromosome 4
Chromosomal Location 140700541-140723220 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 140702275 bp (GRCm38)
Zygosity Homozygous
Amino Acid Change Cysteine to Tyrosine at position 40 (C40Y)
Ref Sequence ENSEMBL: ENSMUSP00000117448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038893] [ENSMUST00000071169] [ENSMUST00000138808]
AlphaFold Q8BK67
Predicted Effect probably benign
Transcript: ENSMUST00000038893
AA Change: C40Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038144
Gene: ENSMUSG00000040945
AA Change: C40Y

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 41 50 N/A INTRINSIC
low complexity region 65 87 N/A INTRINSIC
Pfam:RCC1_2 148 179 6.5e-8 PFAM
Pfam:RCC1 166 215 2.7e-18 PFAM
Pfam:RCC1_2 202 231 5.4e-10 PFAM
Pfam:RCC1 218 267 8.5e-14 PFAM
Pfam:RCC1 270 343 2.9e-13 PFAM
Pfam:RCC1_2 330 359 6.2e-9 PFAM
Pfam:RCC1 347 397 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071169
AA Change: C40Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071163
Gene: ENSMUSG00000040945
AA Change: C40Y

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 41 50 N/A INTRINSIC
low complexity region 65 87 N/A INTRINSIC
Pfam:RCC1_2 148 179 6.1e-8 PFAM
Pfam:RCC1 166 215 4.1e-19 PFAM
Pfam:RCC1_2 202 231 5.1e-10 PFAM
Pfam:RCC1 218 267 1.6e-12 PFAM
Pfam:RCC1 270 343 7.5e-13 PFAM
Pfam:RCC1_2 330 359 1.3e-8 PFAM
Pfam:RCC1 347 397 2.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138808
AA Change: C40Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117448
Gene: ENSMUSG00000040945
AA Change: C40Y

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 41 50 N/A INTRINSIC
low complexity region 65 87 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine exchange factor that is active on RalA, a small GTPase. The encoded protein and RalA are both essential for proper kinetochore-microtubule function in early mitosis. This protein has been shown to be a biomarker for colorectal cancer. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Park2 A G 17: 11,067,296 probably null Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Rcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Rcc2 APN 4 140720591 missense possibly damaging 0.85
IGL02486:Rcc2 APN 4 140710362 missense probably damaging 1.00
PIT4445001:Rcc2 UTSW 4 140721149 missense possibly damaging 0.84
R0637:Rcc2 UTSW 4 140717744 splice site probably benign
R1856:Rcc2 UTSW 4 140720604 missense probably benign 0.17
R2107:Rcc2 UTSW 4 140721185 missense probably damaging 1.00
R2152:Rcc2 UTSW 4 140717117 missense probably damaging 1.00
R4809:Rcc2 UTSW 4 140717042 missense probably damaging 1.00
R5004:Rcc2 UTSW 4 140717666 missense possibly damaging 0.86
R5229:Rcc2 UTSW 4 140717029 missense probably damaging 1.00
R5384:Rcc2 UTSW 4 140720566 nonsense probably null
R5767:Rcc2 UTSW 4 140715919 missense probably damaging 1.00
R5840:Rcc2 UTSW 4 140712138 missense possibly damaging 0.95
R5909:Rcc2 UTSW 4 140717068 missense probably damaging 1.00
R6056:Rcc2 UTSW 4 140717024 missense possibly damaging 0.73
R7086:Rcc2 UTSW 4 140707969 missense probably benign 0.20
R7252:Rcc2 UTSW 4 140702275 missense probably benign 0.00
R7393:Rcc2 UTSW 4 140717030 missense probably damaging 1.00
R8054:Rcc2 UTSW 4 140702275 missense probably benign 0.00
R8055:Rcc2 UTSW 4 140702275 missense probably benign 0.00
R8056:Rcc2 UTSW 4 140702275 missense probably benign 0.00
R8057:Rcc2 UTSW 4 140702275 missense probably benign 0.00
R8058:Rcc2 UTSW 4 140702275 missense probably benign 0.00
R8501:Rcc2 UTSW 4 140715926 missense probably damaging 0.97
R9200:Rcc2 UTSW 4 140718353 missense probably benign 0.00
R9337:Rcc2 UTSW 4 140718378 missense probably damaging 1.00
R9380:Rcc2 UTSW 4 140702391 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CCACGAAAGTTCCTCTTTTCG -3'
(R):5'- ACTGGCTCCCCGGAGTTC -3'

Sequencing Primer
(F):5'- AAAGTTCCTCTTTTCGCGCGTG -3'
(R):5'- TCCCCGGAGTTCCCCCG -3'
Posted On 2018-07-24