Incidental Mutation 'R6698:Lmtk2'
ID 528650
Institutional Source Beutler Lab
Gene Symbol Lmtk2
Ensembl Gene ENSMUSG00000038970
Gene Name lemur tyrosine kinase 2
Synonyms AATYK2, A330101P12Rik, KPI2, cprk, KPI-2, 2900041G10Rik, BREK
MMRRC Submission 044816-MU
Accession Numbers

Genbank: NM_001081109; MGI: 3036247

Essential gene? Possibly non essential (E-score: 0.378) question?
Stock # R6698 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 144100436-144188204 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144174919 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 819 (V819A)
Ref Sequence ENSEMBL: ENSMUSP00000048238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041804]
AlphaFold Q3TYD6
Predicted Effect probably benign
Transcript: ENSMUST00000041804
AA Change: V819A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000048238
Gene: ENSMUSG00000038970
AA Change: V819A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 42 61 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
STYKc 136 406 3.4e-39 SMART
low complexity region 924 953 N/A INTRINSIC
low complexity region 1019 1035 N/A INTRINSIC
low complexity region 1104 1117 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1354 1367 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
Meta Mutation Damage Score 0.0694 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase superfamily and the protein tyrosine kinase family. It contains N-terminal transmembrane helices and a long C-terminal cytoplasmic tail with serine/threonine/tyrosine kinase activity. This protein interacts with several other proteins, such as Inhibitor-2 (Inh2), protein phosphatase-1 (PP1C), p35, and myosin VI. It phosporylates other proteins, and is itself also phosporylated when interacting with cyclin-dependent kinase 5 (cdk5)/p35 complex. This protein involves in nerve growth factor (NGF)-TrkA signalling, and also plays a critical role in endosomal membrane trafficking. Mouse studies suggested an essential role of this protein in spermatogenesis. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation in this gene display partial prenatal lethality, male infertility, and azoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(31) : Targeted, knock-out(1) Gene trapped(30)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Park2 A G 17: 11,067,296 probably null Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Lmtk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmtk2 APN 5 144134155 missense probably damaging 1.00
IGL00496:Lmtk2 APN 5 144174694 missense probably benign
IGL00848:Lmtk2 APN 5 144176398 missense probably benign
IGL01450:Lmtk2 APN 5 144174702 missense probably benign 0.03
IGL01833:Lmtk2 APN 5 144175935 nonsense probably null
IGL01967:Lmtk2 APN 5 144182779 missense probably benign
IGL01998:Lmtk2 APN 5 144176065 missense probably damaging 1.00
IGL02106:Lmtk2 APN 5 144175951 missense probably benign 0.03
IGL02147:Lmtk2 APN 5 144156936 missense possibly damaging 0.78
IGL02581:Lmtk2 APN 5 144148348 missense probably damaging 1.00
madagascar UTSW 5 144174919 missense probably benign 0.02
A4554:Lmtk2 UTSW 5 144166317 missense possibly damaging 0.82
R0039:Lmtk2 UTSW 5 144166387 missense probably damaging 1.00
R0039:Lmtk2 UTSW 5 144166387 missense probably damaging 1.00
R0108:Lmtk2 UTSW 5 144174285 missense possibly damaging 0.78
R0367:Lmtk2 UTSW 5 144174285 missense possibly damaging 0.78
R0515:Lmtk2 UTSW 5 144174991 missense possibly damaging 0.77
R1434:Lmtk2 UTSW 5 144174589 missense probably damaging 1.00
R1617:Lmtk2 UTSW 5 144173862 missense probably damaging 1.00
R1760:Lmtk2 UTSW 5 144174175 missense probably damaging 0.99
R1785:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R1786:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R1907:Lmtk2 UTSW 5 144175110 missense probably benign 0.00
R2130:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2131:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2132:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2133:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2140:Lmtk2 UTSW 5 144147615 missense probably damaging 1.00
R2141:Lmtk2 UTSW 5 144147615 missense probably damaging 1.00
R2210:Lmtk2 UTSW 5 144147609 missense probably damaging 1.00
R2289:Lmtk2 UTSW 5 144176106 missense possibly damaging 0.80
R2312:Lmtk2 UTSW 5 144173626 missense probably damaging 1.00
R2352:Lmtk2 UTSW 5 144173911 missense probably benign 0.05
R3870:Lmtk2 UTSW 5 144166427 splice site probably benign
R4011:Lmtk2 UTSW 5 144175879 missense probably benign 0.01
R4272:Lmtk2 UTSW 5 144183226 missense probably benign 0.05
R4361:Lmtk2 UTSW 5 144147664 missense probably damaging 1.00
R4580:Lmtk2 UTSW 5 144174781 missense possibly damaging 0.56
R4621:Lmtk2 UTSW 5 144174934 missense probably benign 0.02
R4981:Lmtk2 UTSW 5 144176447 missense probably damaging 1.00
R5818:Lmtk2 UTSW 5 144156900 missense probably benign 0.07
R5984:Lmtk2 UTSW 5 144174838 missense probably benign
R6083:Lmtk2 UTSW 5 144182756 missense probably damaging 1.00
R6180:Lmtk2 UTSW 5 144175342 missense probably damaging 1.00
R6411:Lmtk2 UTSW 5 144174586 missense probably damaging 0.99
R6544:Lmtk2 UTSW 5 144173806 missense possibly damaging 0.68
R6628:Lmtk2 UTSW 5 144174685 missense probably benign 0.03
R6742:Lmtk2 UTSW 5 144148357 missense probably damaging 1.00
R6763:Lmtk2 UTSW 5 144173797 missense probably damaging 1.00
R7286:Lmtk2 UTSW 5 144174360 nonsense probably null
R7390:Lmtk2 UTSW 5 144129443 missense possibly damaging 0.79
R7594:Lmtk2 UTSW 5 144173746 missense probably damaging 1.00
R7660:Lmtk2 UTSW 5 144148340 missense probably damaging 1.00
R7785:Lmtk2 UTSW 5 144174753 missense probably benign 0.00
R7977:Lmtk2 UTSW 5 144175141 missense probably benign 0.02
R7987:Lmtk2 UTSW 5 144175141 missense probably benign 0.02
R8089:Lmtk2 UTSW 5 144156900 missense probably benign 0.07
R8138:Lmtk2 UTSW 5 144175597 missense probably damaging 0.99
R8694:Lmtk2 UTSW 5 144171748 missense probably damaging 1.00
R8714:Lmtk2 UTSW 5 144176058 missense probably damaging 1.00
R8816:Lmtk2 UTSW 5 144175975 nonsense probably null
R8845:Lmtk2 UTSW 5 144173886 missense probably damaging 1.00
R8856:Lmtk2 UTSW 5 144176261 missense probably damaging 1.00
R9306:Lmtk2 UTSW 5 144182781 missense probably benign 0.17
R9494:Lmtk2 UTSW 5 144100520 start gained probably benign
X0024:Lmtk2 UTSW 5 144174250 missense probably benign 0.22
Z1088:Lmtk2 UTSW 5 144182851 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTTGTCACAGGGAGACACGC -3'
(R):5'- TTTGTAAATCCTGTCTCGATTCTGG -3'

Sequencing Primer
(F):5'- ACACGCGTGGACAGAATG -3'
(R):5'- CTGTCTCGATTCTGGAAGACAAC -3'
Posted On 2018-07-24