Mutagenetix > Incidental Mutation

Incidental Mutation 'R6698:Lmtk2'

528650

Institutional Source

Beutler Lab

Gene Symbol

Lmtk2

Ensembl Gene

ENSMUSG00000038970

Gene Name

lemur tyrosine kinase 2

Synonyms

AATYK2, A330101P12Rik, KPI2, cprk, KPI-2, 2900041G10Rik, BREK

MMRRC Submission

044816-MU

Accession Numbers

Genbank: NM_001081109; MGI: 3036247

Essential gene?

Possibly non essential (E-score: 0.378) question?

Stock #

R6698 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144100436-144188204 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 144174919 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 819 (V819A)

Ref Sequence

ENSEMBL: ENSMUSP00000048238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041804]

AlphaFold

Q3TYD6

Predicted Effect

probably benign
Transcript: ENSMUST00000041804
AA Change: V819A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000048238
Gene: ENSMUSG00000038970
AA Change: V819A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
transmembrane domain	42	61	N/A	INTRINSIC
low complexity region	72	88	N/A	INTRINSIC
STYKc	136	406	3.4e-39	SMART
low complexity region	924	953	N/A	INTRINSIC
low complexity region	1019	1035	N/A	INTRINSIC
low complexity region	1104	1117	N/A	INTRINSIC
low complexity region	1168	1180	N/A	INTRINSIC
low complexity region	1252	1266	N/A	INTRINSIC
low complexity region	1354	1367	N/A	INTRINSIC
low complexity region	1380	1392	N/A	INTRINSIC

Meta Mutation Damage Score

0.0694

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase superfamily and the protein tyrosine kinase family. It contains N-terminal transmembrane helices and a long C-terminal cytoplasmic tail with serine/threonine/tyrosine kinase activity. This protein interacts with several other proteins, such as Inhibitor-2 (Inh2), protein phosphatase-1 (PP1C), p35, and myosin VI. It phosporylates other proteins, and is itself also phosporylated when interacting with cyclin-dependent kinase 5 (cdk5)/p35 complex. This protein involves in nerve growth factor (NGF)-TrkA signalling, and also plays a critical role in endosomal membrane trafficking. Mouse studies suggested an essential role of this protein in spermatogenesis. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation in this gene display partial prenatal lethality, male infertility, and azoospermia. [provided by MGI curators]

Allele List at MGI

All alleles(31) : Targeted, knock-out(1) Gene trapped(30)

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Brca2	T	C	5: 150,532,394	V200A	probably damaging	Het
Camk2g	T	A	14: 20,742,708	K393*	probably null	Het
Catsperb	T	A	12: 101,509,207	F337I	probably damaging	Het
Cdk17	T	C	10: 93,228,678	Y270H	probably damaging	Het
Col5a3	C	T	9: 20,779,033	G1162R	probably damaging	Het
Col6a5	T	A	9: 105,934,175	N715I	unknown	Het
Fam198b	A	G	3: 79,936,595	I10V	probably damaging	Het
Fancg	A	G	4: 43,007,034	S248P	probably benign	Het
Flvcr1	T	C	1: 191,025,732	Y79C	probably damaging	Het
Gabrp	A	G	11: 33,557,017	S198P	probably damaging	Het
Glp1r	A	G	17: 30,936,401	Y454C	probably damaging	Het
Gpr158	A	C	2: 21,827,110	D1007A	probably damaging	Het
Gsdmc3	A	G	15: 63,860,271	F302S	possibly damaging	Het
Gsdmc4	T	A	15: 63,893,764	D312V	probably benign	Het
Itga5	T	C	15: 103,351,381	Y663C	probably benign	Het
Kif1b	A	T	4: 149,274,956	M108K	probably damaging	Het
Klf11	T	G	12: 24,653,619	S18A	probably damaging	Het
Lrba	A	G	3: 86,304,425	M451V	probably damaging	Het
Lrp1b	T	C	2: 41,302,946	D488G	probably damaging	Het
Mark4	T	C	7: 19,429,437	N589S	probably benign	Het
Mis12	T	C	11: 71,025,186	F15S	probably damaging	Het
Nif3l1	A	G	1: 58,450,489	D179G	probably benign	Het
Nlrx1	A	G	9: 44,265,807	W3R	probably damaging	Het
Nup210l	G	A	3: 90,182,508	S1194N	possibly damaging	Het
Olfr1165-ps	A	G	2: 88,101,217	F257L	unknown	Het
Olfr451-ps1	A	T	6: 42,801,202	T154S	probably benign	Het
Park2	A	G	17: 11,067,296		probably null	Het
Pnkd	T	A	1: 74,350,677	L320Q	probably damaging	Het
Rcc2	G	A	4: 140,702,275	C40Y	probably benign	Homo
Rilpl2	C	T	5: 124,469,780	E126K	probably damaging	Het
Rpn2	T	C	2: 157,297,410	I208T	possibly damaging	Het
Skint4	G	T	4: 112,119,899	C170F	probably damaging	Het
Synj1	C	G	16: 90,960,452	V877L	probably damaging	Het
Tcp11	A	T	17: 28,071,830	I106N	possibly damaging	Het
Tg	A	G	15: 66,839,362	Y991C	probably damaging	Het
Trib3	A	G	2: 152,338,419	S285P	probably damaging	Het
Wdr49	A	T	3: 75,429,366	W345R	probably benign	Het
Wnt5a	A	G	14: 28,518,463	Y190C	possibly damaging	Het
Xpo1	A	G	11: 23,294,040	E955G	probably benign	Het

Other mutations in Lmtk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Lmtk2	APN	5	144134155	missense	probably damaging	1.00
IGL00496:Lmtk2	APN	5	144174694	missense	probably benign
IGL00848:Lmtk2	APN	5	144176398	missense	probably benign
IGL01450:Lmtk2	APN	5	144174702	missense	probably benign	0.03
IGL01833:Lmtk2	APN	5	144175935	nonsense	probably null
IGL01967:Lmtk2	APN	5	144182779	missense	probably benign
IGL01998:Lmtk2	APN	5	144176065	missense	probably damaging	1.00
IGL02106:Lmtk2	APN	5	144175951	missense	probably benign	0.03
IGL02147:Lmtk2	APN	5	144156936	missense	possibly damaging	0.78
IGL02581:Lmtk2	APN	5	144148348	missense	probably damaging	1.00
madagascar	UTSW	5	144174919	missense	probably benign	0.02
A4554:Lmtk2	UTSW	5	144166317	missense	possibly damaging	0.82
R0039:Lmtk2	UTSW	5	144166387	missense	probably damaging	1.00
R0039:Lmtk2	UTSW	5	144166387	missense	probably damaging	1.00
R0108:Lmtk2	UTSW	5	144174285	missense	possibly damaging	0.78
R0367:Lmtk2	UTSW	5	144174285	missense	possibly damaging	0.78
R0515:Lmtk2	UTSW	5	144174991	missense	possibly damaging	0.77
R1434:Lmtk2	UTSW	5	144174589	missense	probably damaging	1.00
R1617:Lmtk2	UTSW	5	144173862	missense	probably damaging	1.00
R1760:Lmtk2	UTSW	5	144174175	missense	probably damaging	0.99
R1785:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R1786:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R1907:Lmtk2	UTSW	5	144175110	missense	probably benign	0.00
R2130:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R2131:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R2132:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R2133:Lmtk2	UTSW	5	144174988	missense	possibly damaging	0.61
R2140:Lmtk2	UTSW	5	144147615	missense	probably damaging	1.00
R2141:Lmtk2	UTSW	5	144147615	missense	probably damaging	1.00
R2210:Lmtk2	UTSW	5	144147609	missense	probably damaging	1.00
R2289:Lmtk2	UTSW	5	144176106	missense	possibly damaging	0.80
R2312:Lmtk2	UTSW	5	144173626	missense	probably damaging	1.00
R2352:Lmtk2	UTSW	5	144173911	missense	probably benign	0.05
R3870:Lmtk2	UTSW	5	144166427	splice site	probably benign
R4011:Lmtk2	UTSW	5	144175879	missense	probably benign	0.01
R4272:Lmtk2	UTSW	5	144183226	missense	probably benign	0.05
R4361:Lmtk2	UTSW	5	144147664	missense	probably damaging	1.00
R4580:Lmtk2	UTSW	5	144174781	missense	possibly damaging	0.56
R4621:Lmtk2	UTSW	5	144174934	missense	probably benign	0.02
R4981:Lmtk2	UTSW	5	144176447	missense	probably damaging	1.00
R5818:Lmtk2	UTSW	5	144156900	missense	probably benign	0.07
R5984:Lmtk2	UTSW	5	144174838	missense	probably benign
R6083:Lmtk2	UTSW	5	144182756	missense	probably damaging	1.00
R6180:Lmtk2	UTSW	5	144175342	missense	probably damaging	1.00
R6411:Lmtk2	UTSW	5	144174586	missense	probably damaging	0.99
R6544:Lmtk2	UTSW	5	144173806	missense	possibly damaging	0.68
R6628:Lmtk2	UTSW	5	144174685	missense	probably benign	0.03
R6742:Lmtk2	UTSW	5	144148357	missense	probably damaging	1.00
R6763:Lmtk2	UTSW	5	144173797	missense	probably damaging	1.00
R7286:Lmtk2	UTSW	5	144174360	nonsense	probably null
R7390:Lmtk2	UTSW	5	144129443	missense	possibly damaging	0.79
R7594:Lmtk2	UTSW	5	144173746	missense	probably damaging	1.00
R7660:Lmtk2	UTSW	5	144148340	missense	probably damaging	1.00
R7785:Lmtk2	UTSW	5	144174753	missense	probably benign	0.00
R7977:Lmtk2	UTSW	5	144175141	missense	probably benign	0.02
R7987:Lmtk2	UTSW	5	144175141	missense	probably benign	0.02
R8089:Lmtk2	UTSW	5	144156900	missense	probably benign	0.07
R8138:Lmtk2	UTSW	5	144175597	missense	probably damaging	0.99
R8694:Lmtk2	UTSW	5	144171748	missense	probably damaging	1.00
R8714:Lmtk2	UTSW	5	144176058	missense	probably damaging	1.00
R8816:Lmtk2	UTSW	5	144175975	nonsense	probably null
R8845:Lmtk2	UTSW	5	144173886	missense	probably damaging	1.00
R8856:Lmtk2	UTSW	5	144176261	missense	probably damaging	1.00
R9306:Lmtk2	UTSW	5	144182781	missense	probably benign	0.17
R9494:Lmtk2	UTSW	5	144100520	start gained	probably benign
X0024:Lmtk2	UTSW	5	144174250	missense	probably benign	0.22
Z1088:Lmtk2	UTSW	5	144182851	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- TTTGTCACAGGGAGACACGC -3'
(R):5'- TTTGTAAATCCTGTCTCGATTCTGG -3'

Sequencing Primer
(F):5'- ACACGCGTGGACAGAATG -3'
(R):5'- CTGTCTCGATTCTGGAAGACAAC -3'

Posted On

2018-07-24