Incidental Mutation 'R6698:Gabrp'
ID528657
Institutional Source Beutler Lab
Gene Symbol Gabrp
Ensembl Gene ENSMUSG00000020159
Gene Namegamma-aminobutyric acid (GABA) A receptor, pi
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6698 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location33550781-33578959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33557017 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 198 (S198P)
Ref Sequence ENSEMBL: ENSMUSP00000020366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020366]
Predicted Effect probably damaging
Transcript: ENSMUST00000020366
AA Change: S198P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020366
Gene: ENSMUSG00000020159
AA Change: S198P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Neur_chan_LBD 40 242 1.3e-49 PFAM
Pfam:Neur_chan_memb 249 353 5.2e-23 PFAM
transmembrane domain 420 437 N/A INTRINSIC
Meta Mutation Damage Score 0.1809 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. The subunit encoded by this gene is expressed in several non-neuronal tissues including the uterus and ovaries. This subunit can assemble with known GABA A receptor subunits, and the presence of this subunit alters the sensitivity of recombinant receptors to modulatory agents such as pregnanolone. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Park2 A G 17: 11,067,296 probably null Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Gabrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Gabrp APN 11 33552644 missense possibly damaging 0.91
IGL01299:Gabrp APN 11 33554476 missense probably damaging 1.00
IGL01305:Gabrp APN 11 33555055 missense probably damaging 1.00
IGL01686:Gabrp APN 11 33552826 nonsense probably null
IGL01729:Gabrp APN 11 33552689 missense probably damaging 1.00
IGL03031:Gabrp APN 11 33554980 missense probably damaging 1.00
IGL03172:Gabrp APN 11 33554388 missense probably damaging 1.00
IGL03280:Gabrp APN 11 33552616 missense probably benign 0.12
ANU22:Gabrp UTSW 11 33555055 missense probably damaging 1.00
R0265:Gabrp UTSW 11 33552614 missense probably damaging 1.00
R0326:Gabrp UTSW 11 33554362 missense probably damaging 0.99
R1744:Gabrp UTSW 11 33572462 missense probably benign 0.03
R4174:Gabrp UTSW 11 33568092 missense probably damaging 1.00
R5043:Gabrp UTSW 11 33568072 missense probably benign 0.00
R5213:Gabrp UTSW 11 33567211 critical splice donor site probably null
R5290:Gabrp UTSW 11 33567310 missense probably damaging 0.99
R5665:Gabrp UTSW 11 33554308 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GCCTGCACATATGTCTGTGTAC -3'
(R):5'- TGTGCTCCTCTAGACTTAATGC -3'

Sequencing Primer
(F):5'- AATTGAACCTGGGACCTCTG -3'
(R):5'- TCTAGACTTAATGCCACCAGGAGAG -3'
Posted On2018-07-24