Incidental Mutation 'R6698:Mis12'
ID 528658
Institutional Source Beutler Lab
Gene Symbol Mis12
Ensembl Gene ENSMUSG00000040599
Gene Name MIS12 kinetochore complex component
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock # R6698 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 71019611-71027371 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71025186 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 15 (F15S)
Ref Sequence ENSEMBL: ENSMUSP00000127782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048807] [ENSMUST00000133413] [ENSMUST00000136137] [ENSMUST00000143762] [ENSMUST00000155236] [ENSMUST00000164220]
AlphaFold Q9CY25
Predicted Effect probably damaging
Transcript: ENSMUST00000048807
AA Change: F15S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039500
Gene: ENSMUSG00000040599
AA Change: F15S

DomainStartEndE-ValueType
Pfam:Mis12 8 141 4.2e-31 PFAM
coiled coil region 179 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133413
Predicted Effect unknown
Transcript: ENSMUST00000136137
AA Change: F15S
Predicted Effect probably benign
Transcript: ENSMUST00000143762
Predicted Effect probably benign
Transcript: ENSMUST00000155236
Predicted Effect probably damaging
Transcript: ENSMUST00000164220
AA Change: F15S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127782
Gene: ENSMUSG00000040599
AA Change: F15S

DomainStartEndE-ValueType
Pfam:Mis12 8 156 2.5e-47 PFAM
coiled coil region 179 206 N/A INTRINSIC
Meta Mutation Damage Score 0.9312 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Park2 A G 17: 11,067,296 probably null Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Mis12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02653:Mis12 APN 11 71025531 missense probably damaging 1.00
R2041:Mis12 UTSW 11 71025306 missense probably damaging 0.99
R4077:Mis12 UTSW 11 71025308 missense probably benign 0.00
R4163:Mis12 UTSW 11 71025656 missense probably benign 0.00
R4697:Mis12 UTSW 11 71025326 missense possibly damaging 0.95
R4951:Mis12 UTSW 11 71025647 missense probably benign
R8675:Mis12 UTSW 11 71025674 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGTGGACAGTTAAGGCTGG -3'
(R):5'- CGTCCTTTCATGAAGCAAAGAAAC -3'

Sequencing Primer
(F):5'- GACTTAAGGTATCAAAGGAACACTC -3'
(R):5'- AGAAACTTCTCTGTGCATTTCCGAG -3'
Posted On 2018-07-24