Mutagenetix > Incidental Mutations

Incidental Mutation 'R6698:Wnt5a'

528662

Institutional Source

Beutler Lab

Gene Symbol

Wnt5a

Ensembl Gene

ENSMUSG00000021994

Gene Name

wingless-type MMTV integration site family, member 5A

Synonyms

8030457G12Rik, Wnt-5a

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6698 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

28504750-28527448 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 28518463 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 190 (Y190C)

Ref Sequence

ENSEMBL: ENSMUSP00000064878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063465] [ENSMUST00000112272]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063465
AA Change: Y190C

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000064878
Gene: ENSMUSG00000021994
AA Change: Y190C

Domain	Start	End	E-Value	Type
Blast:WNT1	1	46	7e-6	BLAST
WNT1	71	380	6.71e-222	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112272
AA Change: Y170C

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000107891
Gene: ENSMUSG00000021994
AA Change: Y170C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WNT1	51	360	6.71e-222	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134163

Meta Mutation Damage Score

0.2685

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene encodes a member of the WNT family that signals through both the canonical and non-canonical WNT pathways. This protein is a ligand for the seven transmembrane receptor frizzled-5 and the tyrosine kinase orphan receptor 2. This protein plays an essential role in regulating developmental pathways during embryogenesis. This protein may also play a role in oncogenesis. Mutations in this gene are the cause of autosomal dominant Robinow syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants exhibit caudal truncation with shortened anterior-posterior axis, truncation of the snout, tongue and mandible, short fore- and hindlimbs, which lack digits, absent genital tubercle and lung abnormalities. Mutants die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Brca2	T	C	5: 150,532,394	V200A	probably damaging	Het
Camk2g	T	A	14: 20,742,708	K393*	probably null	Het
Catsperb	T	A	12: 101,509,207	F337I	probably damaging	Het
Cdk17	T	C	10: 93,228,678	Y270H	probably damaging	Het
Col5a3	C	T	9: 20,779,033	G1162R	probably damaging	Het
Col6a5	T	A	9: 105,934,175	N715I	unknown	Het
Fam198b	A	G	3: 79,936,595	I10V	probably damaging	Het
Fancg	A	G	4: 43,007,034	S248P	probably benign	Het
Flvcr1	T	C	1: 191,025,732	Y79C	probably damaging	Het
Gabrp	A	G	11: 33,557,017	S198P	probably damaging	Het
Glp1r	A	G	17: 30,936,401	Y454C	probably damaging	Het
Gpr158	A	C	2: 21,827,110	D1007A	probably damaging	Het
Gsdmc3	A	G	15: 63,860,271	F302S	possibly damaging	Het
Gsdmc4	T	A	15: 63,893,764	D312V	probably benign	Het
Itga5	T	C	15: 103,351,381	Y663C	probably benign	Het
Kif1b	A	T	4: 149,274,956	M108K	probably damaging	Het
Klf11	T	G	12: 24,653,619	S18A	probably damaging	Het
Lmtk2	T	C	5: 144,174,919	V819A	probably benign	Het
Lrba	A	G	3: 86,304,425	M451V	probably damaging	Het
Lrp1b	T	C	2: 41,302,946	D488G	probably damaging	Het
Mark4	T	C	7: 19,429,437	N589S	probably benign	Het
Mis12	T	C	11: 71,025,186	F15S	probably damaging	Het
Nif3l1	A	G	1: 58,450,489	D179G	probably benign	Het
Nlrx1	A	G	9: 44,265,807	W3R	probably damaging	Het
Nup210l	G	A	3: 90,182,508	S1194N	possibly damaging	Het
Olfr1165-ps	A	G	2: 88,101,217	F257L	unknown	Het
Olfr451-ps1	A	T	6: 42,801,202	T154S	probably benign	Het
Park2	A	G	17: 11,067,296		probably null	Het
Pnkd	T	A	1: 74,350,677	L320Q	probably damaging	Het
Rcc2	G	A	4: 140,702,275	C40Y	probably benign	Homo
Rilpl2	C	T	5: 124,469,780	E126K	probably damaging	Het
Rpn2	T	C	2: 157,297,410	I208T	possibly damaging	Het
Skint4	G	T	4: 112,119,899	C170F	probably damaging	Het
Synj1	C	G	16: 90,960,452	V877L	probably damaging	Het
Tcp11	A	T	17: 28,071,830	I106N	possibly damaging	Het
Tg	A	G	15: 66,839,362	Y991C	probably damaging	Het
Trib3	A	G	2: 152,338,419	S285P	probably damaging	Het
Wdr49	A	T	3: 75,429,366	W345R	probably benign	Het
Xpo1	A	G	11: 23,294,040	E955G	probably benign	Het

Other mutations in Wnt5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Wnt5a	APN	14	28522909	missense	probably damaging	1.00
IGL01945:Wnt5a	APN	14	28518562	missense	probably damaging	1.00
IGL02117:Wnt5a	APN	14	28506120	splice site	probably benign
IGL02995:Wnt5a	APN	14	28522914	missense	probably benign	0.02
IGL03123:Wnt5a	APN	14	28522925	missense	probably damaging	1.00
Thrush	UTSW	14	28518463	missense	possibly damaging	0.78
R0254:Wnt5a	UTSW	14	28522854	missense	probably damaging	1.00
R0277:Wnt5a	UTSW	14	28513268	missense	possibly damaging	0.74
R0365:Wnt5a	UTSW	14	28518504	nonsense	probably null
R1472:Wnt5a	UTSW	14	28518504	nonsense	probably null
R1661:Wnt5a	UTSW	14	28518343	missense	probably benign	0.02
R1662:Wnt5a	UTSW	14	28518343	missense	probably benign	0.02
R1762:Wnt5a	UTSW	14	28522891	missense	probably damaging	1.00
R1791:Wnt5a	UTSW	14	28511878	start codon destroyed	probably null	0.00
R1933:Wnt5a	UTSW	14	28511845	missense	probably benign	0.00
R2147:Wnt5a	UTSW	14	28513317	missense	probably damaging	1.00
R2149:Wnt5a	UTSW	14	28513317	missense	probably damaging	1.00
R3078:Wnt5a	UTSW	14	28513183	nonsense	probably null
R3162:Wnt5a	UTSW	14	28522488	missense	probably benign	0.00
R3162:Wnt5a	UTSW	14	28522488	missense	probably benign	0.00
R4237:Wnt5a	UTSW	14	28522866	missense	probably damaging	1.00
R5396:Wnt5a	UTSW	14	28522770	missense	probably damaging	1.00
R6329:Wnt5a	UTSW	14	28518492	nonsense	probably null
R6974:Wnt5a	UTSW	14	28522570	missense	possibly damaging	0.89
R7114:Wnt5a	UTSW	14	28522756	missense	probably damaging	1.00
R7232:Wnt5a	UTSW	14	28518372	missense	probably benign	0.03
R7457:Wnt5a	UTSW	14	28518279	splice site	probably null
R7666:Wnt5a	UTSW	14	28518372	missense	possibly damaging	0.88
R8273:Wnt5a	UTSW	14	28522605	missense	probably damaging	1.00
T0722:Wnt5a	UTSW	14	28511925	missense	probably benign	0.01
Z1088:Wnt5a	UTSW	14	28522728	missense	probably damaging	0.99
Z1176:Wnt5a	UTSW	14	28511907	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCCTTAATCGCAGGCAGCC -3'
(R):5'- GTATCCGGAGAGACCTGAACTG -3'

Sequencing Primer
(F):5'- CGAGAGACGGCCTTCACGTAC -3'
(R):5'- AGGACCCAACTCCTGTGTGTG -3'

Posted On

2018-07-24