Incidental Mutation 'R6698:Gsdmc4'
ID 528664
Institutional Source Beutler Lab
Gene Symbol Gsdmc4
Ensembl Gene ENSMUSG00000055748
Gene Name gasdermin C4
Synonyms 9030605I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R6698 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 63891264-63912297 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63893764 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 312 (D312V)
Ref Sequence ENSEMBL: ENSMUSP00000140269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063530] [ENSMUST00000188108]
AlphaFold Q3TR54
Predicted Effect probably benign
Transcript: ENSMUST00000063530
AA Change: D312V

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000066072
Gene: ENSMUSG00000055748
AA Change: D312V

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.2e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177709
SMART Domains Protein: ENSMUSP00000137240
Gene: ENSMUSG00000093867

DomainStartEndE-ValueType
Pfam:Gasdermin 4 161 2.1e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186026
Predicted Effect probably benign
Transcript: ENSMUST00000188108
AA Change: D312V

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140269
Gene: ENSMUSG00000055748
AA Change: D312V

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 3.8e-153 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Park2 A G 17: 11,067,296 probably null Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Gsdmc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Gsdmc4 APN 15 63897804 missense probably damaging 1.00
IGL02301:Gsdmc4 APN 15 63895264 missense probably benign 0.00
IGL02586:Gsdmc4 APN 15 63893792 missense probably damaging 0.98
IGL02747:Gsdmc4 APN 15 63893871 missense probably benign 0.04
IGL02829:Gsdmc4 APN 15 63892648 missense probably benign 0.01
IGL03233:Gsdmc4 APN 15 63902860 missense probably damaging 1.00
R0835:Gsdmc4 UTSW 15 63893800 missense probably damaging 1.00
R0981:Gsdmc4 UTSW 15 63892073 missense probably damaging 1.00
R1946:Gsdmc4 UTSW 15 63902780 missense probably benign 0.19
R2350:Gsdmc4 UTSW 15 63893165 missense probably benign
R2967:Gsdmc4 UTSW 15 63902060 missense probably benign 0.19
R3409:Gsdmc4 UTSW 15 63892046 missense probably benign 0.09
R3410:Gsdmc4 UTSW 15 63892046 missense probably benign 0.09
R4067:Gsdmc4 UTSW 15 63893887 splice site probably null
R4840:Gsdmc4 UTSW 15 63893747 missense probably benign 0.24
R5182:Gsdmc4 UTSW 15 63893804 missense probably damaging 1.00
R5624:Gsdmc4 UTSW 15 63892654 missense possibly damaging 0.91
R5910:Gsdmc4 UTSW 15 63895252 missense possibly damaging 0.77
R6533:Gsdmc4 UTSW 15 63892060 missense probably damaging 1.00
R7291:Gsdmc4 UTSW 15 63902840 missense possibly damaging 0.81
R7598:Gsdmc4 UTSW 15 63900386 missense probably damaging 1.00
R7691:Gsdmc4 UTSW 15 63893791 missense probably damaging 1.00
R7851:Gsdmc4 UTSW 15 63902746 nonsense probably null
R7881:Gsdmc4 UTSW 15 63897719 missense possibly damaging 0.91
R8300:Gsdmc4 UTSW 15 63894941 missense probably damaging 0.97
R8512:Gsdmc4 UTSW 15 63891959 missense probably damaging 1.00
R9041:Gsdmc4 UTSW 15 63902737 missense probably benign 0.10
R9357:Gsdmc4 UTSW 15 63900347 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GAACTAGTAGGCCACACTCTC -3'
(R):5'- GGAAATGGTACCATCCCAGG -3'

Sequencing Primer
(F):5'- TAGCCCTCCACATGGTGCATG -3'
(R):5'- GGTACCATCCCAGGGATATTTAATTG -3'
Posted On 2018-07-24