Mutagenetix > Incidental Mutations

Incidental Mutation 'R6698:Itga5'

528666

Institutional Source

Beutler Lab

Gene Symbol

Itga5

Ensembl Gene

ENSMUSG00000000555

Gene Name

integrin alpha 5 (fibronectin receptor alpha)

Synonyms

Fnra, Cd49e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6698 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103344286-103366763 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103351381 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 663 (Y663C)

Ref Sequence

ENSEMBL: ENSMUSP00000023128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023128] [ENSMUST00000215331]

AlphaFold

P11688

Predicted Effect

probably benign
Transcript: ENSMUST00000023128
AA Change: Y663C

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000023128
Gene: ENSMUSG00000000555
AA Change: Y663C

Domain	Start	End	E-Value	Type
low complexity region	17	40	N/A	INTRINSIC
Int_alpha	59	118	2.27e-8	SMART
Int_alpha	271	321	9.6e-7	SMART
Int_alpha	325	387	1.03e-15	SMART
Int_alpha	391	447	4.17e-16	SMART
Int_alpha	455	511	1.49e-3	SMART
SCOP:d1m1xa2	651	789	3e-44	SMART
SCOP:d1m1xa3	792	992	1e-62	SMART
transmembrane domain	1003	1025	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183535

Predicted Effect

probably benign
Transcript: ENSMUST00000215331

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230775

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: The product of this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes the integrin alpha 5 chain, which is proteolytically processed to generate light and heavy chains that join with beta 1 to form a fibronectin receptor. In addition to adhesion, integrins are known to participate in cell-surface mediated signaling. Integrin alpha 5 and integrin alpha V chains are produced by distinct genes. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in posterior trunk and yolk sac mesodermal structures, lack of epithelialization of somites, reduced numbers of Schwann cells, and lethality around embryonic day 10-11. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Brca2	T	C	5: 150,532,394	V200A	probably damaging	Het
Camk2g	T	A	14: 20,742,708	K393*	probably null	Het
Catsperb	T	A	12: 101,509,207	F337I	probably damaging	Het
Cdk17	T	C	10: 93,228,678	Y270H	probably damaging	Het
Col5a3	C	T	9: 20,779,033	G1162R	probably damaging	Het
Col6a5	T	A	9: 105,934,175	N715I	unknown	Het
Fam198b	A	G	3: 79,936,595	I10V	probably damaging	Het
Fancg	A	G	4: 43,007,034	S248P	probably benign	Het
Flvcr1	T	C	1: 191,025,732	Y79C	probably damaging	Het
Gabrp	A	G	11: 33,557,017	S198P	probably damaging	Het
Glp1r	A	G	17: 30,936,401	Y454C	probably damaging	Het
Gpr158	A	C	2: 21,827,110	D1007A	probably damaging	Het
Gsdmc3	A	G	15: 63,860,271	F302S	possibly damaging	Het
Gsdmc4	T	A	15: 63,893,764	D312V	probably benign	Het
Kif1b	A	T	4: 149,274,956	M108K	probably damaging	Het
Klf11	T	G	12: 24,653,619	S18A	probably damaging	Het
Lmtk2	T	C	5: 144,174,919	V819A	probably benign	Het
Lrba	A	G	3: 86,304,425	M451V	probably damaging	Het
Lrp1b	T	C	2: 41,302,946	D488G	probably damaging	Het
Mark4	T	C	7: 19,429,437	N589S	probably benign	Het
Mis12	T	C	11: 71,025,186	F15S	probably damaging	Het
Nif3l1	A	G	1: 58,450,489	D179G	probably benign	Het
Nlrx1	A	G	9: 44,265,807	W3R	probably damaging	Het
Nup210l	G	A	3: 90,182,508	S1194N	possibly damaging	Het
Olfr1165-ps	A	G	2: 88,101,217	F257L	unknown	Het
Olfr451-ps1	A	T	6: 42,801,202	T154S	probably benign	Het
Park2	A	G	17: 11,067,296		probably null	Het
Pnkd	T	A	1: 74,350,677	L320Q	probably damaging	Het
Rcc2	G	A	4: 140,702,275	C40Y	probably benign	Homo
Rilpl2	C	T	5: 124,469,780	E126K	probably damaging	Het
Rpn2	T	C	2: 157,297,410	I208T	possibly damaging	Het
Skint4	G	T	4: 112,119,899	C170F	probably damaging	Het
Synj1	C	G	16: 90,960,452	V877L	probably damaging	Het
Tcp11	A	T	17: 28,071,830	I106N	possibly damaging	Het
Tg	A	G	15: 66,839,362	Y991C	probably damaging	Het
Trib3	A	G	2: 152,338,419	S285P	probably damaging	Het
Wdr49	A	T	3: 75,429,366	W345R	probably benign	Het
Wnt5a	A	G	14: 28,518,463	Y190C	possibly damaging	Het
Xpo1	A	G	11: 23,294,040	E955G	probably benign	Het

Other mutations in Itga5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00914:Itga5	APN	15	103350372	critical splice donor site	probably null
IGL01102:Itga5	APN	15	103346675	missense	probably benign	0.13
IGL01474:Itga5	APN	15	103354270	nonsense	probably null
IGL01768:Itga5	APN	15	103351570	missense	probably benign	0.34
IGL01832:Itga5	APN	15	103355949	nonsense	probably null
IGL02188:Itga5	APN	15	103347717	missense	probably benign	0.30
IGL02701:Itga5	APN	15	103347766	missense	probably damaging	0.98
IGL02838:Itga5	APN	15	103351609	missense	probably damaging	1.00
IGL02955:Itga5	APN	15	103350834	missense	possibly damaging	0.48
R0617:Itga5	UTSW	15	103356315	critical splice donor site	probably null
R0845:Itga5	UTSW	15	103350769	missense	probably benign	0.07
R1210:Itga5	UTSW	15	103357473	missense	possibly damaging	0.76
R1522:Itga5	UTSW	15	103356782	nonsense	probably null
R1576:Itga5	UTSW	15	103351617	missense	probably damaging	0.96
R1666:Itga5	UTSW	15	103347902	missense	probably benign	0.00
R1808:Itga5	UTSW	15	103350399	missense	probably damaging	1.00
R1836:Itga5	UTSW	15	103346014	missense	probably damaging	1.00
R1964:Itga5	UTSW	15	103354314	missense	probably damaging	1.00
R4290:Itga5	UTSW	15	103352257	critical splice donor site	probably null
R4458:Itga5	UTSW	15	103350203	missense	probably damaging	1.00
R4610:Itga5	UTSW	15	103350832	missense	probably damaging	1.00
R4676:Itga5	UTSW	15	103357210	missense	probably damaging	1.00
R4795:Itga5	UTSW	15	103347760	missense	probably benign	0.05
R4796:Itga5	UTSW	15	103347760	missense	probably benign	0.05
R4837:Itga5	UTSW	15	103354084	missense	probably damaging	0.99
R4929:Itga5	UTSW	15	103353235	missense	probably benign	0.42
R5896:Itga5	UTSW	15	103351087	missense	probably benign
R5947:Itga5	UTSW	15	103356785	missense	probably damaging	1.00
R5957:Itga5	UTSW	15	103351429	missense	probably benign	0.05
R6153:Itga5	UTSW	15	103357453	missense	probably damaging	1.00
R6353:Itga5	UTSW	15	103352523	missense	probably damaging	0.98
R6657:Itga5	UTSW	15	103350795	missense	probably damaging	1.00
R6891:Itga5	UTSW	15	103357543	missense	probably damaging	1.00
R6981:Itga5	UTSW	15	103350226	missense	probably benign	0.00
R7574:Itga5	UTSW	15	103350449	missense	probably damaging	1.00
R7762:Itga5	UTSW	15	103349757	missense	probably benign	0.01
R7813:Itga5	UTSW	15	103357314	critical splice acceptor site	probably null
R7984:Itga5	UTSW	15	103355952	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAATAGGGCCTGGGAATAACAC -3'
(R):5'- GGCCAGTTCTACACTACCAAAG -3'

Sequencing Primer
(F):5'- CTGGGAATAACACAGTGGGGC -3'
(R):5'- GTTCTACACTACCAAAGCAAAAGCAG -3'

Posted On

2018-07-24