Incidental Mutation 'R6698:Itga5'
ID 528666
Institutional Source Beutler Lab
Gene Symbol Itga5
Ensembl Gene ENSMUSG00000000555
Gene Name integrin alpha 5 (fibronectin receptor alpha)
Synonyms Fnra, Cd49e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6698 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 103344286-103366763 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103351381 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 663 (Y663C)
Ref Sequence ENSEMBL: ENSMUSP00000023128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023128] [ENSMUST00000215331]
AlphaFold P11688
Predicted Effect probably benign
Transcript: ENSMUST00000023128
AA Change: Y663C

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023128
Gene: ENSMUSG00000000555
AA Change: Y663C

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
Int_alpha 59 118 2.27e-8 SMART
Int_alpha 271 321 9.6e-7 SMART
Int_alpha 325 387 1.03e-15 SMART
Int_alpha 391 447 4.17e-16 SMART
Int_alpha 455 511 1.49e-3 SMART
SCOP:d1m1xa2 651 789 3e-44 SMART
SCOP:d1m1xa3 792 992 1e-62 SMART
transmembrane domain 1003 1025 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183535
Predicted Effect probably benign
Transcript: ENSMUST00000215331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230775
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: The product of this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes the integrin alpha 5 chain, which is proteolytically processed to generate light and heavy chains that join with beta 1 to form a fibronectin receptor. In addition to adhesion, integrins are known to participate in cell-surface mediated signaling. Integrin alpha 5 and integrin alpha V chains are produced by distinct genes. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in posterior trunk and yolk sac mesodermal structures, lack of epithelialization of somites, reduced numbers of Schwann cells, and lethality around embryonic day 10-11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Park2 A G 17: 11,067,296 probably null Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Itga5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Itga5 APN 15 103350372 critical splice donor site probably null
IGL01102:Itga5 APN 15 103346675 missense probably benign 0.13
IGL01474:Itga5 APN 15 103354270 nonsense probably null
IGL01768:Itga5 APN 15 103351570 missense probably benign 0.34
IGL01832:Itga5 APN 15 103355949 nonsense probably null
IGL02188:Itga5 APN 15 103347717 missense probably benign 0.30
IGL02701:Itga5 APN 15 103347766 missense probably damaging 0.98
IGL02838:Itga5 APN 15 103351609 missense probably damaging 1.00
IGL02955:Itga5 APN 15 103350834 missense possibly damaging 0.48
R0617:Itga5 UTSW 15 103356315 critical splice donor site probably null
R0845:Itga5 UTSW 15 103350769 missense probably benign 0.07
R1210:Itga5 UTSW 15 103357473 missense possibly damaging 0.76
R1522:Itga5 UTSW 15 103356782 nonsense probably null
R1576:Itga5 UTSW 15 103351617 missense probably damaging 0.96
R1666:Itga5 UTSW 15 103347902 missense probably benign 0.00
R1808:Itga5 UTSW 15 103350399 missense probably damaging 1.00
R1836:Itga5 UTSW 15 103346014 missense probably damaging 1.00
R1964:Itga5 UTSW 15 103354314 missense probably damaging 1.00
R4290:Itga5 UTSW 15 103352257 critical splice donor site probably null
R4458:Itga5 UTSW 15 103350203 missense probably damaging 1.00
R4610:Itga5 UTSW 15 103350832 missense probably damaging 1.00
R4676:Itga5 UTSW 15 103357210 missense probably damaging 1.00
R4795:Itga5 UTSW 15 103347760 missense probably benign 0.05
R4796:Itga5 UTSW 15 103347760 missense probably benign 0.05
R4837:Itga5 UTSW 15 103354084 missense probably damaging 0.99
R4929:Itga5 UTSW 15 103353235 missense probably benign 0.42
R5896:Itga5 UTSW 15 103351087 missense probably benign
R5947:Itga5 UTSW 15 103356785 missense probably damaging 1.00
R5957:Itga5 UTSW 15 103351429 missense probably benign 0.05
R6153:Itga5 UTSW 15 103357453 missense probably damaging 1.00
R6353:Itga5 UTSW 15 103352523 missense probably damaging 0.98
R6657:Itga5 UTSW 15 103350795 missense probably damaging 1.00
R6891:Itga5 UTSW 15 103357543 missense probably damaging 1.00
R6981:Itga5 UTSW 15 103350226 missense probably benign 0.00
R7574:Itga5 UTSW 15 103350449 missense probably damaging 1.00
R7762:Itga5 UTSW 15 103349757 missense probably benign 0.01
R7813:Itga5 UTSW 15 103357314 critical splice acceptor site probably null
R7984:Itga5 UTSW 15 103355952 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATAGGGCCTGGGAATAACAC -3'
(R):5'- GGCCAGTTCTACACTACCAAAG -3'

Sequencing Primer
(F):5'- CTGGGAATAACACAGTGGGGC -3'
(R):5'- GTTCTACACTACCAAAGCAAAAGCAG -3'
Posted On 2018-07-24