Incidental Mutation 'R6698:Park2'
ID 528668
Institutional Source Beutler Lab
Gene Symbol Park2
Ensembl Gene ENSMUSG00000023826
Gene Name Parkinson disease (autosomal recessive, juvenile) 2, parkin
Synonyms PRKN
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock # R6698 (G1)
Quality Score 181.009
Status Validated
Chromosome 17
Chromosomal Location 10840384-12063361 bp(+) (GRCm38)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) A to G at 11067296 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168593] [ENSMUST00000191124] [ENSMUST00000218435]
AlphaFold Q9WVS6
Predicted Effect noncoding transcript
Transcript: ENSMUST00000066658
SMART Domains Protein: ENSMUSP00000063644
Gene: ENSMUSG00000023826

DomainStartEndE-ValueType
UBQ 2 71 1.31e-13 SMART
Blast:UBQ 202 229 5e-6 BLAST
Blast:RING 236 287 9e-11 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000168593
SMART Domains Protein: ENSMUSP00000127455
Gene: ENSMUSG00000023826

DomainStartEndE-ValueType
UBQ 2 71 1.31e-13 SMART
Blast:UBQ 202 229 3e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186167
Predicted Effect probably null
Transcript: ENSMUST00000191124
SMART Domains Protein: ENSMUSP00000140587
Gene: ENSMUSG00000023826

DomainStartEndE-ValueType
UBQ 1 72 3.58e-15 SMART
Blast:UBQ 203 230 2e-6 BLAST
Blast:RING 237 295 7e-11 BLAST
IBR 312 376 1.2e-14 SMART
IBR 400 456 5.16e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000218435
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The precise function of this gene is unknown; however, the encoded protein is a component of a multiprotein E3 ubiquitin ligase complex that mediates the targeting of substrate proteins for proteasomal degradation. Mutations in this gene are known to cause Parkinson disease and autosomal recessive juvenile Parkinson disease. Alternative splicing of this gene produces multiple transcript variants encoding distinct isoforms. Additional splice variants of this gene have been described but currently lack transcript support. [provided by RefSeq, Jul 2008]
PHENOTYPE: Dopamine and glutatamate transmission are impaired in some targeted null mice, resulting in decreased exploratory behavior. These mice show decreased body weight and temperature. Park2 is inactivated as part of a large deletion in the quaking mouse, a dysmyelinating mutant with a pronounced tremor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Park2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Park2 UTSW 17 11854763 missense probably damaging 1.00
FR4340:Park2 UTSW 17 11854763 missense probably damaging 1.00
FR4342:Park2 UTSW 17 11854763 missense probably damaging 1.00
PIT4651001:Park2 UTSW 17 11067243 missense probably damaging 1.00
R0333:Park2 UTSW 17 11067140 missense probably damaging 1.00
R0543:Park2 UTSW 17 11067179 missense probably damaging 1.00
R4460:Park2 UTSW 17 12061646 missense probably damaging 1.00
R4710:Park2 UTSW 17 11854833 missense possibly damaging 0.89
R4742:Park2 UTSW 17 11237704 critical splice donor site probably null
R4752:Park2 UTSW 17 12004123 missense probably benign
R4911:Park2 UTSW 17 10840472 utr 5 prime probably benign
R5653:Park2 UTSW 17 11237649 missense probably damaging 1.00
R5654:Park2 UTSW 17 11237649 missense probably damaging 1.00
R5655:Park2 UTSW 17 11237649 missense probably damaging 1.00
R6360:Park2 UTSW 17 12004052 missense probably damaging 1.00
R7163:Park2 UTSW 17 12061547 missense probably damaging 1.00
R7241:Park2 UTSW 17 11854861 missense possibly damaging 0.63
R7475:Park2 UTSW 17 11434614 missense probably benign
R7630:Park2 UTSW 17 11237568 missense probably benign
R8278:Park2 UTSW 17 12050722 missense probably benign 0.26
R8299:Park2 UTSW 17 11237521 missense probably benign 0.25
R8551:Park2 UTSW 17 11067216 missense probably damaging 0.99
R8558:Park2 UTSW 17 11237585 missense probably benign
R8706:Park2 UTSW 17 11237585 missense probably benign
R8867:Park2 UTSW 17 11237561 missense probably benign 0.00
R9241:Park2 UTSW 17 11237495 missense probably benign 0.10
R9272:Park2 UTSW 17 11237640 missense probably damaging 1.00
R9450:Park2 UTSW 17 11838634 missense possibly damaging 0.95
X0010:Park2 UTSW 17 11237576 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGTTTGTCAGGTTCAACTCC -3'
(R):5'- TTCACTAAACTGAGCGCGCG -3'

Sequencing Primer
(F):5'- GTCAGGTTCAACTCCAGCTATG -3'
(R):5'- GGTCTTGGCTCACCCACAC -3'
Posted On 2018-07-24