Mutagenetix > Incidental Mutations

Incidental Mutation 'R6698:Park2'

528668

Institutional Source

Beutler Lab

Gene Symbol

Park2

Ensembl Gene

ENSMUSG00000023826

Gene Name

Parkinson disease (autosomal recessive, juvenile) 2, parkin

Synonyms

PRKN

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.174) question?

Stock #

R6698 (G1)

Quality Score

181.009

Status

Validated

Chromosome

Chromosomal Location

10840384-12063361 bp(+) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

A to G at 11067296 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168593] [ENSMUST00000191124] [ENSMUST00000218435]

AlphaFold

Q9WVS6

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000066658

SMART Domains

Protein: ENSMUSP00000063644
Gene: ENSMUSG00000023826

Domain	Start	End	E-Value	Type
UBQ	2	71	1.31e-13	SMART
Blast:UBQ	202	229	5e-6	BLAST
Blast:RING	236	287	9e-11	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000168593

SMART Domains

Protein: ENSMUSP00000127455
Gene: ENSMUSG00000023826

Domain	Start	End	E-Value	Type
UBQ	2	71	1.31e-13	SMART
Blast:UBQ	202	229	3e-6	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186167

Predicted Effect

probably null
Transcript: ENSMUST00000191124

SMART Domains

Protein: ENSMUSP00000140587
Gene: ENSMUSG00000023826

Domain	Start	End	E-Value	Type
UBQ	1	72	3.58e-15	SMART
Blast:UBQ	203	230	2e-6	BLAST
Blast:RING	237	295	7e-11	BLAST
IBR	312	376	1.2e-14	SMART
IBR	400	456	5.16e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000218435

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The precise function of this gene is unknown; however, the encoded protein is a component of a multiprotein E3 ubiquitin ligase complex that mediates the targeting of substrate proteins for proteasomal degradation. Mutations in this gene are known to cause Parkinson disease and autosomal recessive juvenile Parkinson disease. Alternative splicing of this gene produces multiple transcript variants encoding distinct isoforms. Additional splice variants of this gene have been described but currently lack transcript support. [provided by RefSeq, Jul 2008]
PHENOTYPE: Dopamine and glutatamate transmission are impaired in some targeted null mice, resulting in decreased exploratory behavior. These mice show decreased body weight and temperature. Park2 is inactivated as part of a large deletion in the quaking mouse, a dysmyelinating mutant with a pronounced tremor. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Brca2	T	C	5: 150,532,394	V200A	probably damaging	Het
Camk2g	T	A	14: 20,742,708	K393*	probably null	Het
Catsperb	T	A	12: 101,509,207	F337I	probably damaging	Het
Cdk17	T	C	10: 93,228,678	Y270H	probably damaging	Het
Col5a3	C	T	9: 20,779,033	G1162R	probably damaging	Het
Col6a5	T	A	9: 105,934,175	N715I	unknown	Het
Fam198b	A	G	3: 79,936,595	I10V	probably damaging	Het
Fancg	A	G	4: 43,007,034	S248P	probably benign	Het
Flvcr1	T	C	1: 191,025,732	Y79C	probably damaging	Het
Gabrp	A	G	11: 33,557,017	S198P	probably damaging	Het
Glp1r	A	G	17: 30,936,401	Y454C	probably damaging	Het
Gpr158	A	C	2: 21,827,110	D1007A	probably damaging	Het
Gsdmc3	A	G	15: 63,860,271	F302S	possibly damaging	Het
Gsdmc4	T	A	15: 63,893,764	D312V	probably benign	Het
Itga5	T	C	15: 103,351,381	Y663C	probably benign	Het
Kif1b	A	T	4: 149,274,956	M108K	probably damaging	Het
Klf11	T	G	12: 24,653,619	S18A	probably damaging	Het
Lmtk2	T	C	5: 144,174,919	V819A	probably benign	Het
Lrba	A	G	3: 86,304,425	M451V	probably damaging	Het
Lrp1b	T	C	2: 41,302,946	D488G	probably damaging	Het
Mark4	T	C	7: 19,429,437	N589S	probably benign	Het
Mis12	T	C	11: 71,025,186	F15S	probably damaging	Het
Nif3l1	A	G	1: 58,450,489	D179G	probably benign	Het
Nlrx1	A	G	9: 44,265,807	W3R	probably damaging	Het
Nup210l	G	A	3: 90,182,508	S1194N	possibly damaging	Het
Olfr1165-ps	A	G	2: 88,101,217	F257L	unknown	Het
Olfr451-ps1	A	T	6: 42,801,202	T154S	probably benign	Het
Pnkd	T	A	1: 74,350,677	L320Q	probably damaging	Het
Rcc2	G	A	4: 140,702,275	C40Y	probably benign	Homo
Rilpl2	C	T	5: 124,469,780	E126K	probably damaging	Het
Rpn2	T	C	2: 157,297,410	I208T	possibly damaging	Het
Skint4	G	T	4: 112,119,899	C170F	probably damaging	Het
Synj1	C	G	16: 90,960,452	V877L	probably damaging	Het
Tcp11	A	T	17: 28,071,830	I106N	possibly damaging	Het
Tg	A	G	15: 66,839,362	Y991C	probably damaging	Het
Trib3	A	G	2: 152,338,419	S285P	probably damaging	Het
Wdr49	A	T	3: 75,429,366	W345R	probably benign	Het
Wnt5a	A	G	14: 28,518,463	Y190C	possibly damaging	Het
Xpo1	A	G	11: 23,294,040	E955G	probably benign	Het

Other mutations in Park2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
FR4304:Park2	UTSW	17	11854763	missense	probably damaging	1.00
FR4340:Park2	UTSW	17	11854763	missense	probably damaging	1.00
FR4342:Park2	UTSW	17	11854763	missense	probably damaging	1.00
PIT4651001:Park2	UTSW	17	11067243	missense	probably damaging	1.00
R0333:Park2	UTSW	17	11067140	missense	probably damaging	1.00
R0543:Park2	UTSW	17	11067179	missense	probably damaging	1.00
R4460:Park2	UTSW	17	12061646	missense	probably damaging	1.00
R4710:Park2	UTSW	17	11854833	missense	possibly damaging	0.89
R4742:Park2	UTSW	17	11237704	critical splice donor site	probably null
R4752:Park2	UTSW	17	12004123	missense	probably benign
R4911:Park2	UTSW	17	10840472	utr 5 prime	probably benign
R5653:Park2	UTSW	17	11237649	missense	probably damaging	1.00
R5654:Park2	UTSW	17	11237649	missense	probably damaging	1.00
R5655:Park2	UTSW	17	11237649	missense	probably damaging	1.00
R6360:Park2	UTSW	17	12004052	missense	probably damaging	1.00
R7163:Park2	UTSW	17	12061547	missense	probably damaging	1.00
R7241:Park2	UTSW	17	11854861	missense	possibly damaging	0.63
R7475:Park2	UTSW	17	11434614	missense	probably benign
R7630:Park2	UTSW	17	11237568	missense	probably benign
R8278:Park2	UTSW	17	12050722	missense	probably benign	0.26
R8299:Park2	UTSW	17	11237521	missense	probably benign	0.25
R8551:Park2	UTSW	17	11067216	missense	probably damaging	0.99
R8558:Park2	UTSW	17	11237585	missense	probably benign
R8706:Park2	UTSW	17	11237585	missense	probably benign
R8867:Park2	UTSW	17	11237561	missense	probably benign	0.00
R9241:Park2	UTSW	17	11237495	missense	probably benign	0.10
R9272:Park2	UTSW	17	11237640	missense	probably damaging	1.00
R9450:Park2	UTSW	17	11838634	missense	possibly damaging	0.95
X0010:Park2	UTSW	17	11237576	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTGTTTGTCAGGTTCAACTCC -3'
(R):5'- TTCACTAAACTGAGCGCGCG -3'

Sequencing Primer
(F):5'- GTCAGGTTCAACTCCAGCTATG -3'
(R):5'- GGTCTTGGCTCACCCACAC -3'

Posted On

2018-07-24