Incidental Mutation 'R6698:Tcp11'
ID528669
Institutional Source Beutler Lab
Gene Symbol Tcp11
Ensembl Gene ENSMUSG00000062859
Gene Namet-complex protein 11
SynonymsD17Ken1, Tcp-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6698 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location28066747-28080639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28071830 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 106 (I106N)
Ref Sequence ENSEMBL: ENSMUSP00000116959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042692] [ENSMUST00000043925] [ENSMUST00000114836] [ENSMUST00000129046] [ENSMUST00000141806]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042692
AA Change: I185N

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038590
Gene: ENSMUSG00000062859
AA Change: I185N

DomainStartEndE-ValueType
Pfam:Tcp11 126 550 6.2e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043925
AA Change: I106N

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046002
Gene: ENSMUSG00000062859
AA Change: I106N

DomainStartEndE-ValueType
Pfam:Tcp11 44 474 3.3e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114836
AA Change: I106N

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110485
Gene: ENSMUSG00000062859
AA Change: I106N

DomainStartEndE-ValueType
Pfam:Tcp11 44 474 3.3e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123628
Predicted Effect possibly damaging
Transcript: ENSMUST00000129046
AA Change: I106N

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116959
Gene: ENSMUSG00000062859
AA Change: I106N

DomainStartEndE-ValueType
Pfam:Tcp11 44 237 2.5e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134228
Predicted Effect probably benign
Transcript: ENSMUST00000141806
SMART Domains Protein: ENSMUSP00000122010
Gene: ENSMUSG00000062859

DomainStartEndE-ValueType
Pfam:Tcp11 123 183 7.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142461
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc3 A G 15: 63,860,271 F302S possibly damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Park2 A G 17: 11,067,296 probably null Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Tcp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02993:Tcp11 APN 17 28070516 missense probably damaging 1.00
IGL03148:Tcp11 APN 17 28070470 missense possibly damaging 0.95
R0487:Tcp11 UTSW 17 28079923 splice site probably null
R0603:Tcp11 UTSW 17 28067810 missense probably damaging 1.00
R0745:Tcp11 UTSW 17 28067160 missense possibly damaging 0.80
R1170:Tcp11 UTSW 17 28071662 missense probably damaging 1.00
R2965:Tcp11 UTSW 17 28069265 missense probably benign 0.38
R5249:Tcp11 UTSW 17 28071783 missense possibly damaging 0.71
R5358:Tcp11 UTSW 17 28078020 missense probably benign 0.05
R5819:Tcp11 UTSW 17 28069236 missense probably damaging 1.00
R6190:Tcp11 UTSW 17 28071717 missense probably benign 0.00
R6657:Tcp11 UTSW 17 28071672 missense probably damaging 1.00
R7020:Tcp11 UTSW 17 28071705 missense possibly damaging 0.79
R7084:Tcp11 UTSW 17 28067021 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TCGTCTCGGATTGGCGCA -3'
(R):5'- GAACCCATTGCTGCTCATCT -3'

Sequencing Primer
(F):5'- TCGGATTGGCGCACACAAC -3'
(R):5'- GCTACACAGAGAAAGCCTGTCTTG -3'
Posted On2018-07-24