Incidental Mutation 'R6699:Ankrd44'
ID528671
Institutional Source Beutler Lab
Gene Symbol Ankrd44
Ensembl Gene ENSMUSG00000052331
Gene Nameankyrin repeat domain 44
SynonymsE130014H08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R6699 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location54645340-54926387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54762445 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 241 (T241I)
Ref Sequence ENSEMBL: ENSMUSP00000137616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044359] [ENSMUST00000177679] [ENSMUST00000178226] [ENSMUST00000179030]
Predicted Effect probably damaging
Transcript: ENSMUST00000044359
AA Change: T241I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040327
Gene: ENSMUSG00000052331
AA Change: T241I

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 5.98e1 SMART
ANK 422 451 7.13e-6 SMART
ANK 455 484 1.18e-6 SMART
ANK 488 545 1.17e2 SMART
ANK 549 579 3.31e-1 SMART
ANK 584 613 3.91e-3 SMART
ANK 617 646 1.43e-5 SMART
ANK 651 680 2.73e-2 SMART
ANK 687 716 5.41e-6 SMART
ANK 720 749 5.53e-3 SMART
ANK 753 785 1.52e0 SMART
ANK 789 819 9.27e-5 SMART
ANK 821 851 1.52e0 SMART
ANK 856 885 6.02e-4 SMART
ANK 889 919 3.08e-1 SMART
ANK 923 955 3.36e-2 SMART
ANK 959 988 6.26e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177679
SMART Domains Protein: ENSMUSP00000137216
Gene: ENSMUSG00000052331

DomainStartEndE-ValueType
ANK 15 44 3.23e-4 SMART
ANK 48 77 1.12e-3 SMART
ANK 81 110 1.65e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177919
Predicted Effect probably damaging
Transcript: ENSMUST00000178226
AA Change: T38I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136802
Gene: ENSMUSG00000052331
AA Change: T38I

DomainStartEndE-ValueType
ANK 2 31 1.1e-6 SMART
ANK 35 64 9.7e-8 SMART
ANK 68 98 1.11e-2 SMART
ANK 102 131 9.35e-1 SMART
ANK 135 164 2.02e-5 SMART
ANK 168 197 5.98e1 SMART
ANK 219 248 7.13e-6 SMART
ANK 252 281 1.18e-6 SMART
ANK 285 342 1.17e2 SMART
ANK 346 376 3.31e-1 SMART
ANK 381 410 3.91e-3 SMART
ANK 414 443 1.43e-5 SMART
ANK 448 477 2.73e-2 SMART
ANK 484 513 5.41e-6 SMART
ANK 517 546 5.53e-3 SMART
ANK 550 582 1.52e0 SMART
ANK 586 616 9.27e-5 SMART
ANK 618 648 1.52e0 SMART
ANK 653 682 6.02e-4 SMART
ANK 686 716 3.08e-1 SMART
ANK 720 752 3.36e-2 SMART
ANK 756 785 6.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178935
Predicted Effect probably damaging
Transcript: ENSMUST00000179030
AA Change: T241I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137616
Gene: ENSMUSG00000052331
AA Change: T241I

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 3.26e0 SMART
ANK 404 433 7.13e-6 SMART
ANK 437 466 1.18e-6 SMART
ANK 470 527 1.17e2 SMART
ANK 531 561 3.31e-1 SMART
ANK 566 595 3.91e-3 SMART
ANK 599 628 1.43e-5 SMART
ANK 633 662 2.73e-2 SMART
ANK 669 698 5.41e-6 SMART
ANK 702 731 5.53e-3 SMART
ANK 735 767 1.52e0 SMART
ANK 771 801 9.27e-5 SMART
ANK 803 833 1.52e0 SMART
ANK 838 867 6.02e-4 SMART
ANK 871 901 3.08e-1 SMART
ANK 905 937 3.36e-2 SMART
ANK 941 970 6.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188243
Meta Mutation Damage Score 0.4564 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,144,368 T894A probably damaging Het
Adam39 A G 8: 40,826,657 K695R probably benign Het
Agfg1 G A 1: 82,858,454 probably null Het
Car15 T C 16: 17,836,574 D166G probably null Het
Cpne2 G A 8: 94,563,959 V391M probably damaging Het
Ddx27 C T 2: 167,020,503 T155I possibly damaging Het
F830045P16Rik T C 2: 129,460,421 D417G probably damaging Het
Fam217b T G 2: 178,420,417 M58R probably benign Het
Ftmt T C 18: 52,331,665 S18P possibly damaging Het
Gm16494 C T 17: 47,016,908 V17M probably damaging Het
Gm36864 A T 7: 44,238,772 I342F possibly damaging Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Hist1h4k A T 13: 21,750,504 M1K probably null Het
Hmgcr T C 13: 96,660,209 E191G probably damaging Het
Hrc A G 7: 45,335,695 D90G possibly damaging Het
Kbtbd7 A G 14: 79,428,192 E488G probably benign Het
Krtap26-1 T C 16: 88,647,715 N6S unknown Het
Mgat2 A G 12: 69,184,781 D43G probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Olfr1124 A T 2: 87,434,816 I110F probably benign Het
Olfr224 T A 11: 58,567,205 I47L possibly damaging Het
Pcdhb11 T A 18: 37,422,937 V440E probably damaging Het
Pcdhb18 T A 18: 37,491,952 H778Q probably benign Het
Plekha7 T C 7: 116,135,175 E1025G probably damaging Het
Rnf39 T C 17: 36,947,229 W96R probably damaging Het
Rph3al A T 11: 75,900,837 probably benign Het
Rrm1 T A 7: 102,460,825 Y556N probably damaging Het
Saal1 A T 7: 46,692,817 C401S probably damaging Het
Sec14l3 T C 11: 4,075,193 S268P possibly damaging Het
Tmem54 A G 4: 129,111,325 I199M probably benign Het
Tomm70a A G 16: 57,142,802 M395V probably benign Het
Topors A G 4: 40,262,300 V328A probably damaging Het
Vmn2r61 T G 7: 42,300,156 S667A probably benign Het
Vmn2r68 G A 7: 85,232,375 A499V possibly damaging Het
Zcchc14 A T 8: 121,608,616 probably benign Het
Other mutations in Ankrd44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Ankrd44 APN 1 54662647 splice site probably benign
IGL00839:Ankrd44 APN 1 54667435 missense probably benign 0.27
IGL01145:Ankrd44 APN 1 54762259 critical splice donor site probably null
IGL01380:Ankrd44 APN 1 54727565 missense probably benign 0.00
IGL01415:Ankrd44 APN 1 54752928 missense probably damaging 1.00
IGL01958:Ankrd44 APN 1 54766966 missense probably damaging 0.99
IGL02014:Ankrd44 APN 1 54657620 missense possibly damaging 0.95
IGL02745:Ankrd44 APN 1 54766791 missense probably damaging 1.00
IGL03008:Ankrd44 APN 1 54766809 missense probably damaging 1.00
wilderness UTSW 1 54735034 synonymous silent
PIT4812001:Ankrd44 UTSW 1 54723038 nonsense probably null
R0416:Ankrd44 UTSW 1 54743339 missense possibly damaging 0.63
R0554:Ankrd44 UTSW 1 54763758 missense probably benign 0.00
R0575:Ankrd44 UTSW 1 54762310 missense probably damaging 1.00
R1323:Ankrd44 UTSW 1 54766450 splice site probably benign
R1605:Ankrd44 UTSW 1 54828622 missense probably benign 0.36
R2032:Ankrd44 UTSW 1 54723009 splice site probably null
R4458:Ankrd44 UTSW 1 54762391 missense possibly damaging 0.92
R4610:Ankrd44 UTSW 1 54766748 intron probably benign
R4727:Ankrd44 UTSW 1 54667417 missense probably benign 0.05
R4780:Ankrd44 UTSW 1 54763757 missense probably benign 0.00
R4801:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4802:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4810:Ankrd44 UTSW 1 54735143 intron probably benign
R4961:Ankrd44 UTSW 1 54663912 missense probably damaging 1.00
R5053:Ankrd44 UTSW 1 54735089 nonsense probably null
R5093:Ankrd44 UTSW 1 54763718 missense probably damaging 1.00
R5155:Ankrd44 UTSW 1 54778330 missense probably benign 0.43
R5248:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
R5306:Ankrd44 UTSW 1 54926203 utr 5 prime probably benign
R5595:Ankrd44 UTSW 1 54735050 missense probably damaging 1.00
R5595:Ankrd44 UTSW 1 54762347 missense probably damaging 1.00
R6288:Ankrd44 UTSW 1 54763763 missense probably damaging 1.00
R6332:Ankrd44 UTSW 1 54762273 missense probably damaging 1.00
R6453:Ankrd44 UTSW 1 54657704 splice site probably null
R6610:Ankrd44 UTSW 1 54655087 missense probably benign 0.02
R6905:Ankrd44 UTSW 1 54792494 missense probably damaging 1.00
R7173:Ankrd44 UTSW 1 54766391 missense probably damaging 1.00
R7178:Ankrd44 UTSW 1 54649440 missense
R7219:Ankrd44 UTSW 1 54766910 missense probably damaging 1.00
R7276:Ankrd44 UTSW 1 54735080 missense probably benign 0.05
R7283:Ankrd44 UTSW 1 54729796 missense probably damaging 1.00
R7414:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
R7490:Ankrd44 UTSW 1 54648300 missense probably benign 0.03
R7501:Ankrd44 UTSW 1 54649363 missense
R7515:Ankrd44 UTSW 1 54766355 missense probably damaging 1.00
R7527:Ankrd44 UTSW 1 54648324 missense probably benign 0.08
R7807:Ankrd44 UTSW 1 54792476 missense probably damaging 1.00
RF021:Ankrd44 UTSW 1 54778312 missense probably damaging 1.00
Z1088:Ankrd44 UTSW 1 54658982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAGTGCAAAAGTGTTTAAGG -3'
(R):5'- ATAACCTGCTGGGGAGCAAG -3'

Sequencing Primer
(F):5'- GTCATACCTGAATGTTCACATCGG -3'
(R):5'- AGCAAGTGAGCTCTGAATAATTATTC -3'
Posted On2018-07-24