Incidental Mutation 'R6699:Agfg1'
ID528672
Institutional Source Beutler Lab
Gene Symbol Agfg1
Ensembl Gene ENSMUSG00000026159
Gene NameArfGAP with FG repeats 1
SynonymsC130049H11Rik, Rip, D730048C23Rik, Hrb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6699 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location82839483-82901182 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 82858454 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063380] [ENSMUST00000113444] [ENSMUST00000186043] [ENSMUST00000186302] [ENSMUST00000187899] [ENSMUST00000189220] [ENSMUST00000190052]
Predicted Effect probably null
Transcript: ENSMUST00000063380
SMART Domains Protein: ENSMUSP00000070250
Gene: ENSMUSG00000026159

DomainStartEndE-ValueType
ArfGap 11 135 9.31e-52 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 214 258 N/A INTRINSIC
low complexity region 337 353 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
internal_repeat_1 415 450 2.43e-6 PROSPERO
low complexity region 452 465 N/A INTRINSIC
low complexity region 489 510 N/A INTRINSIC
internal_repeat_1 518 558 2.43e-6 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000113444
SMART Domains Protein: ENSMUSP00000109071
Gene: ENSMUSG00000026159

DomainStartEndE-ValueType
ArfGap 11 135 4.7e-54 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 214 258 N/A INTRINSIC
low complexity region 337 353 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
internal_repeat_1 415 450 2.62e-6 PROSPERO
low complexity region 452 465 N/A INTRINSIC
low complexity region 489 510 N/A INTRINSIC
internal_repeat_1 520 560 2.62e-6 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000186043
SMART Domains Protein: ENSMUSP00000140678
Gene: ENSMUSG00000026159

DomainStartEndE-ValueType
ArfGap 1 66 4.1e-5 SMART
PDB:2VX8|D 86 117 7e-7 PDB
low complexity region 145 189 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000186302
SMART Domains Protein: ENSMUSP00000140785
Gene: ENSMUSG00000026159

DomainStartEndE-ValueType
ArfGap 11 135 4.6e-54 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 214 258 N/A INTRINSIC
low complexity region 337 353 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
internal_repeat_1 415 450 2.62e-6 PROSPERO
low complexity region 452 465 N/A INTRINSIC
low complexity region 489 510 N/A INTRINSIC
internal_repeat_1 520 560 2.62e-6 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000187899
SMART Domains Protein: ENSMUSP00000139503
Gene: ENSMUSG00000026159

DomainStartEndE-ValueType
ArfGap 11 135 4.6e-54 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 215 231 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 317 331 N/A INTRINSIC
internal_repeat_1 375 410 6.63e-6 PROSPERO
low complexity region 412 425 N/A INTRINSIC
low complexity region 449 470 N/A INTRINSIC
internal_repeat_1 480 520 6.63e-6 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000189220
SMART Domains Protein: ENSMUSP00000140170
Gene: ENSMUSG00000026159

DomainStartEndE-ValueType
ArfGap 11 135 9.31e-52 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 214 258 N/A INTRINSIC
low complexity region 337 353 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
internal_repeat_1 415 450 2.43e-6 PROSPERO
low complexity region 452 465 N/A INTRINSIC
low complexity region 489 510 N/A INTRINSIC
internal_repeat_1 518 558 2.43e-6 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000190046
Predicted Effect probably null
Transcript: ENSMUST00000190052
SMART Domains Protein: ENSMUSP00000141157
Gene: ENSMUSG00000026159

DomainStartEndE-ValueType
ArfGap 11 135 4.6e-54 SMART
PDB:2VX8|D 155 186 3e-6 PDB
low complexity region 215 231 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 317 331 N/A INTRINSIC
internal_repeat_1 375 410 2.33e-5 PROSPERO
low complexity region 465 486 N/A INTRINSIC
internal_repeat_1 496 536 2.33e-5 PROSPERO
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is related to nucleoporins, a class of proteins that mediate nucleocytoplasmic transport. The encoded protein binds the activation domain of the human immunodeficiency virus Rev protein when Rev is assembled onto its RNA target, and is required for the nuclear export of Rev-directed RNAs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Male mice homozygous for disruptions in this gene are infertile as a result of abnormalities in spermatogenesis. Otherwise, males and females are normal and live a normal life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,144,368 T894A probably damaging Het
Adam39 A G 8: 40,826,657 K695R probably benign Het
Ankrd44 G A 1: 54,762,445 T241I probably damaging Het
Car15 T C 16: 17,836,574 D166G probably null Het
Cpne2 G A 8: 94,563,959 V391M probably damaging Het
Ddx27 C T 2: 167,020,503 T155I possibly damaging Het
F830045P16Rik T C 2: 129,460,421 D417G probably damaging Het
Fam217b T G 2: 178,420,417 M58R probably benign Het
Ftmt T C 18: 52,331,665 S18P possibly damaging Het
Gm16494 C T 17: 47,016,908 V17M probably damaging Het
Gm36864 A T 7: 44,238,772 I342F possibly damaging Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Hist1h4k A T 13: 21,750,504 M1K probably null Het
Hmgcr T C 13: 96,660,209 E191G probably damaging Het
Hrc A G 7: 45,335,695 D90G possibly damaging Het
Kbtbd7 A G 14: 79,428,192 E488G probably benign Het
Krtap26-1 T C 16: 88,647,715 N6S unknown Het
Mgat2 A G 12: 69,184,781 D43G probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Olfr1124 A T 2: 87,434,816 I110F probably benign Het
Olfr224 T A 11: 58,567,205 I47L possibly damaging Het
Pcdhb11 T A 18: 37,422,937 V440E probably damaging Het
Pcdhb18 T A 18: 37,491,952 H778Q probably benign Het
Plekha7 T C 7: 116,135,175 E1025G probably damaging Het
Rnf39 T C 17: 36,947,229 W96R probably damaging Het
Rph3al A T 11: 75,900,837 probably benign Het
Rrm1 T A 7: 102,460,825 Y556N probably damaging Het
Saal1 A T 7: 46,692,817 C401S probably damaging Het
Sec14l3 T C 11: 4,075,193 S268P possibly damaging Het
Tmem54 A G 4: 129,111,325 I199M probably benign Het
Tomm70a A G 16: 57,142,802 M395V probably benign Het
Topors A G 4: 40,262,300 V328A probably damaging Het
Vmn2r61 T G 7: 42,300,156 S667A probably benign Het
Vmn2r68 G A 7: 85,232,375 A499V possibly damaging Het
Zcchc14 A T 8: 121,608,616 probably benign Het
Other mutations in Agfg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Agfg1 APN 1 82858403 missense probably damaging 1.00
IGL02066:Agfg1 APN 1 82893558 missense probably damaging 1.00
IGL02447:Agfg1 APN 1 82882223 splice site probably benign
R0038:Agfg1 UTSW 1 82886102 splice site probably benign
R0038:Agfg1 UTSW 1 82886102 splice site probably benign
R0548:Agfg1 UTSW 1 82886431 missense probably damaging 0.97
R0962:Agfg1 UTSW 1 82886396 missense probably damaging 1.00
R1213:Agfg1 UTSW 1 82875334 missense probably damaging 1.00
R1638:Agfg1 UTSW 1 82893538 missense probably damaging 1.00
R4078:Agfg1 UTSW 1 82882287 missense possibly damaging 0.94
R4477:Agfg1 UTSW 1 82875340 missense probably damaging 1.00
R4780:Agfg1 UTSW 1 82886387 missense probably damaging 1.00
R5103:Agfg1 UTSW 1 82893567 missense probably damaging 1.00
R5576:Agfg1 UTSW 1 82870724 missense probably benign 0.01
R5663:Agfg1 UTSW 1 82893452 missense probably damaging 1.00
R6314:Agfg1 UTSW 1 82858434 missense probably damaging 1.00
R7266:Agfg1 UTSW 1 82882245 missense probably benign 0.00
R7408:Agfg1 UTSW 1 82882309 missense probably damaging 1.00
R7474:Agfg1 UTSW 1 82882411 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAGAATGCTAGTACTCTGGATTC -3'
(R):5'- CTACAGCCAGCACTGCTAAG -3'

Sequencing Primer
(F):5'- TGCTAGTACTCTGGATTCTAACTAC -3'
(R):5'- GCCAGCACTGCTAAGTTTTAAATACC -3'
Posted On2018-07-24