Incidental Mutation 'R6699:Olfr1124'
ID528673
Institutional Source Beutler Lab
Gene Symbol Olfr1124
Ensembl Gene ENSMUSG00000050772
Gene Nameolfactory receptor 1124
SynonymsMOR264-3, Olfr1125, GA_x6K02T2Q125-48935224-48935664, GA_x6K02T2Q125-48936945-48937901, MOR264-24
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6699 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87430275-87436623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87434816 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 110 (I110F)
Ref Sequence ENSEMBL: ENSMUSP00000150244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062494] [ENSMUST00000215909]
Predicted Effect probably benign
Transcript: ENSMUST00000062494
AA Change: I110F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062513
Gene: ENSMUSG00000050772
AA Change: I110F

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 4.2e-52 PFAM
Pfam:7tm_1 47 296 2.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215909
AA Change: I110F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,144,368 T894A probably damaging Het
Adam39 A G 8: 40,826,657 K695R probably benign Het
Agfg1 G A 1: 82,858,454 probably null Het
Ankrd44 G A 1: 54,762,445 T241I probably damaging Het
Car15 T C 16: 17,836,574 D166G probably null Het
Cpne2 G A 8: 94,563,959 V391M probably damaging Het
Ddx27 C T 2: 167,020,503 T155I possibly damaging Het
F830045P16Rik T C 2: 129,460,421 D417G probably damaging Het
Fam217b T G 2: 178,420,417 M58R probably benign Het
Ftmt T C 18: 52,331,665 S18P possibly damaging Het
Gm16494 C T 17: 47,016,908 V17M probably damaging Het
Gm36864 A T 7: 44,238,772 I342F possibly damaging Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Hist1h4k A T 13: 21,750,504 M1K probably null Het
Hmgcr T C 13: 96,660,209 E191G probably damaging Het
Hrc A G 7: 45,335,695 D90G possibly damaging Het
Kbtbd7 A G 14: 79,428,192 E488G probably benign Het
Krtap26-1 T C 16: 88,647,715 N6S unknown Het
Mgat2 A G 12: 69,184,781 D43G probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Olfr224 T A 11: 58,567,205 I47L possibly damaging Het
Pcdhb11 T A 18: 37,422,937 V440E probably damaging Het
Pcdhb18 T A 18: 37,491,952 H778Q probably benign Het
Plekha7 T C 7: 116,135,175 E1025G probably damaging Het
Rnf39 T C 17: 36,947,229 W96R probably damaging Het
Rph3al A T 11: 75,900,837 probably benign Het
Rrm1 T A 7: 102,460,825 Y556N probably damaging Het
Saal1 A T 7: 46,692,817 C401S probably damaging Het
Sec14l3 T C 11: 4,075,193 S268P possibly damaging Het
Tmem54 A G 4: 129,111,325 I199M probably benign Het
Tomm70a A G 16: 57,142,802 M395V probably benign Het
Topors A G 4: 40,262,300 V328A probably damaging Het
Vmn2r61 T G 7: 42,300,156 S667A probably benign Het
Vmn2r68 G A 7: 85,232,375 A499V possibly damaging Het
Zcchc14 A T 8: 121,608,616 probably benign Het
Other mutations in Olfr1124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Olfr1124 APN 2 87435063 missense probably benign 0.00
IGL01655:Olfr1124 APN 2 87434885 missense probably damaging 1.00
IGL01878:Olfr1124 APN 2 87434970 missense possibly damaging 0.55
IGL02265:Olfr1124 APN 2 87435344 missense probably benign 0.00
IGL02379:Olfr1124 APN 2 87435324 missense probably benign 0.07
IGL02512:Olfr1124 APN 2 87435058 missense possibly damaging 0.59
IGL02578:Olfr1124 APN 2 87435057 missense probably damaging 0.96
R0617:Olfr1124 UTSW 2 87434661 missense probably damaging 1.00
R1376:Olfr1124 UTSW 2 87434559 missense possibly damaging 0.62
R1376:Olfr1124 UTSW 2 87434559 missense possibly damaging 0.62
R4993:Olfr1124 UTSW 2 87435152 missense probably benign 0.00
R5045:Olfr1124 UTSW 2 87435146 missense probably damaging 1.00
R6119:Olfr1124 UTSW 2 87435389 nonsense probably null
R6146:Olfr1124 UTSW 2 87435318 missense possibly damaging 0.78
R6883:Olfr1124 UTSW 2 87435279 missense probably damaging 0.99
R6966:Olfr1124 UTSW 2 87435279 missense probably damaging 0.98
R7383:Olfr1124 UTSW 2 87435377 missense possibly damaging 0.91
R8069:Olfr1124 UTSW 2 87435020 missense possibly damaging 0.89
Z1088:Olfr1124 UTSW 2 87435159 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCCAGTGGGTTCTATTTGGAC -3'
(R):5'- TGTCTGCCCTATCTGAATTGG -3'

Sequencing Primer
(F):5'- TCATCCTATTAGGCAATGGCAC -3'
(R):5'- ATTGGGATTCCACTTATCCAGGAGC -3'
Posted On2018-07-24