Incidental Mutation 'R6699:F830045P16Rik'
ID528674
Institutional Source Beutler Lab
Gene Symbol F830045P16Rik
Ensembl Gene ENSMUSG00000043727
Gene NameRIKEN cDNA F830045P16 gene
SynonymsSirpb3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6699 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location129458359-129536602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129460421 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 417 (D417G)
Ref Sequence ENSEMBL: ENSMUSP00000058047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050309]
Predicted Effect probably damaging
Transcript: ENSMUST00000050309
AA Change: D417G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058047
Gene: ENSMUSG00000043727
AA Change: D417G

DomainStartEndE-ValueType
IG_like 51 123 7.95e-2 SMART
IGc1 156 227 5.66e-4 SMART
Pfam:C2-set_2 264 331 1.6e-6 PFAM
IGc1 359 432 2.28e-7 SMART
transmembrane domain 460 482 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,144,368 T894A probably damaging Het
Adam39 A G 8: 40,826,657 K695R probably benign Het
Agfg1 G A 1: 82,858,454 probably null Het
Ankrd44 G A 1: 54,762,445 T241I probably damaging Het
Car15 T C 16: 17,836,574 D166G probably null Het
Cpne2 G A 8: 94,563,959 V391M probably damaging Het
Ddx27 C T 2: 167,020,503 T155I possibly damaging Het
Fam217b T G 2: 178,420,417 M58R probably benign Het
Ftmt T C 18: 52,331,665 S18P possibly damaging Het
Gm16494 C T 17: 47,016,908 V17M probably damaging Het
Gm36864 A T 7: 44,238,772 I342F possibly damaging Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Hist1h4k A T 13: 21,750,504 M1K probably null Het
Hmgcr T C 13: 96,660,209 E191G probably damaging Het
Hrc A G 7: 45,335,695 D90G possibly damaging Het
Kbtbd7 A G 14: 79,428,192 E488G probably benign Het
Krtap26-1 T C 16: 88,647,715 N6S unknown Het
Mgat2 A G 12: 69,184,781 D43G probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Olfr1124 A T 2: 87,434,816 I110F probably benign Het
Olfr224 T A 11: 58,567,205 I47L possibly damaging Het
Pcdhb11 T A 18: 37,422,937 V440E probably damaging Het
Pcdhb18 T A 18: 37,491,952 H778Q probably benign Het
Plekha7 T C 7: 116,135,175 E1025G probably damaging Het
Rnf39 T C 17: 36,947,229 W96R probably damaging Het
Rph3al A T 11: 75,900,837 probably benign Het
Rrm1 T A 7: 102,460,825 Y556N probably damaging Het
Saal1 A T 7: 46,692,817 C401S probably damaging Het
Sec14l3 T C 11: 4,075,193 S268P possibly damaging Het
Tmem54 A G 4: 129,111,325 I199M probably benign Het
Tomm70a A G 16: 57,142,802 M395V probably benign Het
Topors A G 4: 40,262,300 V328A probably damaging Het
Vmn2r61 T G 7: 42,300,156 S667A probably benign Het
Vmn2r68 G A 7: 85,232,375 A499V possibly damaging Het
Zcchc14 A T 8: 121,608,616 probably benign Het
Other mutations in F830045P16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:F830045P16Rik APN 2 129460529 missense probably damaging 0.97
IGL01149:F830045P16Rik APN 2 129460312 critical splice donor site probably null
IGL01556:F830045P16Rik APN 2 129463720 missense probably benign 0.01
IGL01690:F830045P16Rik APN 2 129472694 missense probably damaging 1.00
IGL02169:F830045P16Rik APN 2 129463572 missense probably damaging 1.00
IGL03194:F830045P16Rik APN 2 129460320 missense possibly damaging 0.91
IGL03231:F830045P16Rik APN 2 129460473 missense probably damaging 1.00
R0062:F830045P16Rik UTSW 2 129463704 missense possibly damaging 0.94
R0062:F830045P16Rik UTSW 2 129463704 missense possibly damaging 0.94
R0234:F830045P16Rik UTSW 2 129463464 missense possibly damaging 0.85
R0234:F830045P16Rik UTSW 2 129463464 missense possibly damaging 0.85
R0333:F830045P16Rik UTSW 2 129472857 missense probably damaging 0.96
R0479:F830045P16Rik UTSW 2 129472688 missense possibly damaging 0.86
R0550:F830045P16Rik UTSW 2 129463509 missense probably damaging 1.00
R0827:F830045P16Rik UTSW 2 129472776 missense probably benign 0.01
R1087:F830045P16Rik UTSW 2 129472719 missense possibly damaging 0.55
R1142:F830045P16Rik UTSW 2 129460332 nonsense probably null
R1642:F830045P16Rik UTSW 2 129463714 missense probably benign 0.00
R2022:F830045P16Rik UTSW 2 129472665 missense probably damaging 1.00
R2044:F830045P16Rik UTSW 2 129459397 missense possibly damaging 0.68
R4008:F830045P16Rik UTSW 2 129463547 missense probably damaging 1.00
R4009:F830045P16Rik UTSW 2 129463547 missense probably damaging 1.00
R4011:F830045P16Rik UTSW 2 129463547 missense probably damaging 1.00
R4212:F830045P16Rik UTSW 2 129460353 missense probably benign 0.00
R4579:F830045P16Rik UTSW 2 129463503 missense probably damaging 0.97
R4838:F830045P16Rik UTSW 2 129460550 missense possibly damaging 0.95
R5190:F830045P16Rik UTSW 2 129472715 missense probably benign 0.01
R5217:F830045P16Rik UTSW 2 129463573 missense probably damaging 1.00
R5297:F830045P16Rik UTSW 2 129460553 missense probably benign 0.10
R5352:F830045P16Rik UTSW 2 129472901 missense probably damaging 0.98
R6063:F830045P16Rik UTSW 2 129474390 missense probably damaging 1.00
R6072:F830045P16Rik UTSW 2 129472694 missense probably damaging 1.00
R6173:F830045P16Rik UTSW 2 129463668 missense probably damaging 1.00
R6383:F830045P16Rik UTSW 2 129536438 missense probably benign 0.04
R6386:F830045P16Rik UTSW 2 129472818 missense probably damaging 1.00
R6425:F830045P16Rik UTSW 2 129460580 missense probably damaging 1.00
R6869:F830045P16Rik UTSW 2 129474561 missense probably damaging 0.99
R7751:F830045P16Rik UTSW 2 129460447 missense probably damaging 1.00
R8012:F830045P16Rik UTSW 2 129474432 missense possibly damaging 0.92
R8097:F830045P16Rik UTSW 2 129463585 missense possibly damaging 0.55
Z1176:F830045P16Rik UTSW 2 129536530 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCTATGGAAGAAACCTCAAGACTCC -3'
(R):5'- TGACTGTCACTTGCCATGTG -3'

Sequencing Primer
(F):5'- CCTTAGAGTCTTCTGAAATGCAGC -3'
(R):5'- ATGTGCAGAGATTCTATCCCCAGG -3'
Posted On2018-07-24