Incidental Mutation 'R6699:9530053A07Rik'
ID 528680
Institutional Source Beutler Lab
Gene Symbol 9530053A07Rik
Ensembl Gene ENSMUSG00000078776
Gene Name RIKEN cDNA 9530053A07 gene
Synonyms
MMRRC Submission 044817-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.120) question?
Stock # R6699 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 28129466-28164811 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28144368 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 894 (T894A)
Ref Sequence ENSEMBL: ENSMUSP00000114986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
AlphaFold E9PVG8
Predicted Effect probably damaging
Transcript: ENSMUST00000059886
AA Change: T894A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: T894A

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130693
Predicted Effect probably damaging
Transcript: ENSMUST00000150948
AA Change: T894A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: T894A

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 A G 8: 40,826,657 (GRCm38) K695R probably benign Het
Agfg1 G A 1: 82,858,454 (GRCm38) probably null Het
Ankrd44 G A 1: 54,762,445 (GRCm38) T241I probably damaging Het
Car15 T C 16: 17,836,574 (GRCm38) D166G probably null Het
Cpne2 G A 8: 94,563,959 (GRCm38) V391M probably damaging Het
Ddx27 C T 2: 167,020,503 (GRCm38) T155I possibly damaging Het
F830045P16Rik T C 2: 129,460,421 (GRCm38) D417G probably damaging Het
Fam217b T G 2: 178,420,417 (GRCm38) M58R probably benign Het
Ftmt T C 18: 52,331,665 (GRCm38) S18P possibly damaging Het
Gm16494 C T 17: 47,016,908 (GRCm38) V17M probably damaging Het
Gm36864 A T 7: 44,238,772 (GRCm38) I342F possibly damaging Het
Grid2 C G 6: 63,931,047 (GRCm38) R224G possibly damaging Het
Hist1h4k A T 13: 21,750,504 (GRCm38) M1K probably null Het
Hmgcr T C 13: 96,660,209 (GRCm38) E191G probably damaging Het
Hrc A G 7: 45,335,695 (GRCm38) D90G possibly damaging Het
Kbtbd7 A G 14: 79,428,192 (GRCm38) E488G probably benign Het
Krtap26-1 T C 16: 88,647,715 (GRCm38) N6S unknown Het
Mgat2 A G 12: 69,184,781 (GRCm38) D43G probably damaging Het
Mrps30 A T 13: 118,380,598 (GRCm38) S362T probably damaging Het
Olfr1124 A T 2: 87,434,816 (GRCm38) I110F probably benign Het
Olfr224 T A 11: 58,567,205 (GRCm38) I47L possibly damaging Het
Pcdhb11 T A 18: 37,422,937 (GRCm38) V440E probably damaging Het
Pcdhb18 T A 18: 37,491,952 (GRCm38) H778Q probably benign Het
Plekha7 T C 7: 116,135,175 (GRCm38) E1025G probably damaging Het
Rnf39 T C 17: 36,947,229 (GRCm38) W96R probably damaging Het
Rph3al A T 11: 75,900,837 (GRCm38) probably benign Het
Rrm1 T A 7: 102,460,825 (GRCm38) Y556N probably damaging Het
Saal1 A T 7: 46,692,817 (GRCm38) C401S probably damaging Het
Sec14l3 T C 11: 4,075,193 (GRCm38) S268P possibly damaging Het
Tmem54 A G 4: 129,111,325 (GRCm38) I199M probably benign Het
Tomm70a A G 16: 57,142,802 (GRCm38) M395V probably benign Het
Topors A G 4: 40,262,300 (GRCm38) V328A probably damaging Het
Vmn2r61 T G 7: 42,300,156 (GRCm38) S667A probably benign Het
Vmn2r68 G A 7: 85,232,375 (GRCm38) A499V possibly damaging Het
Zcchc14 A T 8: 121,608,616 (GRCm38) probably benign Het
Other mutations in 9530053A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:9530053A07Rik APN 7 28,164,528 (GRCm38) missense probably damaging 1.00
IGL00757:9530053A07Rik APN 7 28,154,445 (GRCm38) missense probably damaging 1.00
IGL01015:9530053A07Rik APN 7 28,155,318 (GRCm38) missense probably damaging 1.00
IGL01079:9530053A07Rik APN 7 28,139,778 (GRCm38) missense probably damaging 0.99
IGL01343:9530053A07Rik APN 7 28,150,702 (GRCm38) missense probably benign 0.19
IGL01420:9530053A07Rik APN 7 28,140,133 (GRCm38) missense probably benign 0.28
IGL01604:9530053A07Rik APN 7 28,155,324 (GRCm38) missense probably benign 0.11
IGL01666:9530053A07Rik APN 7 28,153,292 (GRCm38) missense probably damaging 1.00
IGL02002:9530053A07Rik APN 7 28,152,796 (GRCm38) missense probably damaging 1.00
IGL02036:9530053A07Rik APN 7 28,137,525 (GRCm38) missense possibly damaging 0.82
IGL02126:9530053A07Rik APN 7 28,139,856 (GRCm38) missense probably damaging 1.00
IGL02150:9530053A07Rik APN 7 28,146,779 (GRCm38) nonsense probably null
IGL02219:9530053A07Rik APN 7 28,154,635 (GRCm38) missense probably damaging 1.00
IGL02563:9530053A07Rik APN 7 28,157,892 (GRCm38) missense probably benign
IGL02804:9530053A07Rik APN 7 28,153,370 (GRCm38) missense probably benign 0.00
IGL02830:9530053A07Rik APN 7 28,162,923 (GRCm38) missense probably damaging 1.00
IGL02943:9530053A07Rik APN 7 28,147,188 (GRCm38) missense probably damaging 1.00
IGL02977:9530053A07Rik APN 7 28,164,372 (GRCm38) missense possibly damaging 0.83
IGL03231:9530053A07Rik APN 7 28,153,722 (GRCm38) missense possibly damaging 0.95
IGL03304:9530053A07Rik APN 7 28,142,242 (GRCm38) missense probably damaging 0.99
herz UTSW 7 28,153,839 (GRCm38) missense possibly damaging 0.72
pulse UTSW 7 28,153,749 (GRCm38) missense probably damaging 1.00
Sinusoidal UTSW 7 28,140,130 (GRCm38) missense probably damaging 1.00
PIT4378001:9530053A07Rik UTSW 7 28,154,464 (GRCm38) missense possibly damaging 0.61
R0023:9530053A07Rik UTSW 7 28,153,412 (GRCm38) missense probably benign 0.00
R0131:9530053A07Rik UTSW 7 28,137,615 (GRCm38) missense probably damaging 1.00
R0131:9530053A07Rik UTSW 7 28,137,615 (GRCm38) missense probably damaging 1.00
R0132:9530053A07Rik UTSW 7 28,137,615 (GRCm38) missense probably damaging 1.00
R0158:9530053A07Rik UTSW 7 28,155,492 (GRCm38) missense probably damaging 1.00
R0230:9530053A07Rik UTSW 7 28,156,825 (GRCm38) missense probably damaging 1.00
R0310:9530053A07Rik UTSW 7 28,142,274 (GRCm38) missense probably benign 0.04
R0448:9530053A07Rik UTSW 7 28,140,235 (GRCm38) missense probably benign 0.03
R0462:9530053A07Rik UTSW 7 28,137,340 (GRCm38) missense probably damaging 1.00
R0481:9530053A07Rik UTSW 7 28,153,749 (GRCm38) missense probably damaging 1.00
R0497:9530053A07Rik UTSW 7 28,147,465 (GRCm38) missense probably damaging 1.00
R0556:9530053A07Rik UTSW 7 28,159,378 (GRCm38) missense probably benign
R0562:9530053A07Rik UTSW 7 28,162,690 (GRCm38) missense probably benign 0.30
R0586:9530053A07Rik UTSW 7 28,137,091 (GRCm38) missense probably damaging 0.99
R0924:9530053A07Rik UTSW 7 28,140,130 (GRCm38) missense probably damaging 1.00
R0930:9530053A07Rik UTSW 7 28,140,130 (GRCm38) missense probably damaging 1.00
R1103:9530053A07Rik UTSW 7 28,154,520 (GRCm38) missense probably damaging 1.00
R1213:9530053A07Rik UTSW 7 28,157,673 (GRCm38) missense probably damaging 1.00
R1292:9530053A07Rik UTSW 7 28,142,794 (GRCm38) splice site probably benign
R1368:9530053A07Rik UTSW 7 28,159,478 (GRCm38) missense possibly damaging 0.89
R1451:9530053A07Rik UTSW 7 28,137,157 (GRCm38) missense probably damaging 1.00
R1477:9530053A07Rik UTSW 7 28,157,093 (GRCm38) missense probably benign 0.01
R1538:9530053A07Rik UTSW 7 28,155,492 (GRCm38) missense probably damaging 1.00
R1655:9530053A07Rik UTSW 7 28,147,110 (GRCm38) missense probably damaging 0.98
R1697:9530053A07Rik UTSW 7 28,154,347 (GRCm38) missense probably damaging 1.00
R1741:9530053A07Rik UTSW 7 28,157,854 (GRCm38) missense probably damaging 0.98
R1796:9530053A07Rik UTSW 7 28,155,372 (GRCm38) missense probably damaging 1.00
R1853:9530053A07Rik UTSW 7 28,155,546 (GRCm38) nonsense probably null
R1861:9530053A07Rik UTSW 7 28,154,732 (GRCm38) missense probably damaging 1.00
R1909:9530053A07Rik UTSW 7 28,144,348 (GRCm38) missense possibly damaging 0.52
R1971:9530053A07Rik UTSW 7 28,131,512 (GRCm38) missense possibly damaging 0.90
R1990:9530053A07Rik UTSW 7 28,154,360 (GRCm38) missense probably damaging 0.98
R2020:9530053A07Rik UTSW 7 28,155,594 (GRCm38) missense probably benign
R2084:9530053A07Rik UTSW 7 28,157,535 (GRCm38) missense probably damaging 1.00
R2125:9530053A07Rik UTSW 7 28,158,022 (GRCm38) missense probably benign 0.00
R2132:9530053A07Rik UTSW 7 28,155,474 (GRCm38) missense probably damaging 1.00
R2513:9530053A07Rik UTSW 7 28,131,635 (GRCm38) missense probably damaging 0.99
R2913:9530053A07Rik UTSW 7 28,164,307 (GRCm38) missense probably damaging 1.00
R3150:9530053A07Rik UTSW 7 28,154,195 (GRCm38) missense probably benign 0.21
R3499:9530053A07Rik UTSW 7 28,154,555 (GRCm38) missense probably benign 0.42
R3702:9530053A07Rik UTSW 7 28,157,778 (GRCm38) missense probably damaging 1.00
R3881:9530053A07Rik UTSW 7 28,140,038 (GRCm38) nonsense probably null
R3938:9530053A07Rik UTSW 7 28,154,294 (GRCm38) missense probably damaging 1.00
R4050:9530053A07Rik UTSW 7 28,152,985 (GRCm38) missense possibly damaging 0.55
R4152:9530053A07Rik UTSW 7 28,156,897 (GRCm38) missense possibly damaging 0.47
R4168:9530053A07Rik UTSW 7 28,137,109 (GRCm38) missense probably benign 0.05
R4235:9530053A07Rik UTSW 7 28,156,648 (GRCm38) missense probably damaging 0.99
R4241:9530053A07Rik UTSW 7 28,154,335 (GRCm38) missense probably damaging 1.00
R4363:9530053A07Rik UTSW 7 28,146,906 (GRCm38) missense probably damaging 1.00
R4460:9530053A07Rik UTSW 7 28,152,856 (GRCm38) missense probably benign 0.17
R4463:9530053A07Rik UTSW 7 28,150,719 (GRCm38) missense probably benign
R4841:9530053A07Rik UTSW 7 28,150,722 (GRCm38) missense probably damaging 1.00
R4842:9530053A07Rik UTSW 7 28,150,722 (GRCm38) missense probably damaging 1.00
R4876:9530053A07Rik UTSW 7 28,142,800 (GRCm38) intron probably benign
R4905:9530053A07Rik UTSW 7 28,156,983 (GRCm38) missense possibly damaging 0.93
R4997:9530053A07Rik UTSW 7 28,143,924 (GRCm38) missense possibly damaging 0.77
R5091:9530053A07Rik UTSW 7 28,156,958 (GRCm38) missense probably benign 0.44
R5159:9530053A07Rik UTSW 7 28,153,308 (GRCm38) missense probably benign 0.09
R5326:9530053A07Rik UTSW 7 28,155,489 (GRCm38) missense probably damaging 0.98
R5396:9530053A07Rik UTSW 7 28,140,183 (GRCm38) missense probably benign
R5441:9530053A07Rik UTSW 7 28,156,914 (GRCm38) missense probably damaging 1.00
R5480:9530053A07Rik UTSW 7 28,157,999 (GRCm38) nonsense probably null
R5542:9530053A07Rik UTSW 7 28,155,489 (GRCm38) missense probably damaging 0.98
R5571:9530053A07Rik UTSW 7 28,156,569 (GRCm38) missense probably damaging 0.99
R5613:9530053A07Rik UTSW 7 28,142,878 (GRCm38) intron probably benign
R5637:9530053A07Rik UTSW 7 28,152,852 (GRCm38) missense probably benign 0.00
R5766:9530053A07Rik UTSW 7 28,137,329 (GRCm38) nonsense probably null
R6174:9530053A07Rik UTSW 7 28,139,959 (GRCm38) missense probably damaging 0.96
R6233:9530053A07Rik UTSW 7 28,131,460 (GRCm38) missense probably damaging 0.99
R6250:9530053A07Rik UTSW 7 28,150,714 (GRCm38) missense probably damaging 1.00
R6379:9530053A07Rik UTSW 7 28,157,592 (GRCm38) missense probably damaging 1.00
R6442:9530053A07Rik UTSW 7 28,144,186 (GRCm38) missense possibly damaging 0.88
R6478:9530053A07Rik UTSW 7 28,155,373 (GRCm38) missense probably damaging 1.00
R6852:9530053A07Rik UTSW 7 28,147,135 (GRCm38) missense probably damaging 1.00
R6883:9530053A07Rik UTSW 7 28,152,835 (GRCm38) missense possibly damaging 0.89
R6902:9530053A07Rik UTSW 7 28,137,213 (GRCm38) missense probably damaging 1.00
R6903:9530053A07Rik UTSW 7 28,137,213 (GRCm38) missense probably damaging 1.00
R6904:9530053A07Rik UTSW 7 28,137,213 (GRCm38) missense probably damaging 1.00
R6992:9530053A07Rik UTSW 7 28,140,183 (GRCm38) missense probably benign 0.04
R7023:9530053A07Rik UTSW 7 28,140,038 (GRCm38) nonsense probably null
R7039:9530053A07Rik UTSW 7 28,140,148 (GRCm38) missense possibly damaging 0.80
R7171:9530053A07Rik UTSW 7 28,154,519 (GRCm38) nonsense probably null
R7282:9530053A07Rik UTSW 7 28,144,408 (GRCm38) missense probably benign 0.02
R7291:9530053A07Rik UTSW 7 28,140,220 (GRCm38) missense probably benign
R7344:9530053A07Rik UTSW 7 28,152,760 (GRCm38) missense possibly damaging 0.46
R7344:9530053A07Rik UTSW 7 28,140,279 (GRCm38) missense possibly damaging 0.79
R7392:9530053A07Rik UTSW 7 28,164,372 (GRCm38) missense possibly damaging 0.83
R7531:9530053A07Rik UTSW 7 28,140,231 (GRCm38) missense probably benign
R7541:9530053A07Rik UTSW 7 28,144,256 (GRCm38) nonsense probably null
R7577:9530053A07Rik UTSW 7 28,154,423 (GRCm38) missense possibly damaging 0.65
R7594:9530053A07Rik UTSW 7 28,131,460 (GRCm38) missense probably damaging 0.99
R7647:9530053A07Rik UTSW 7 28,140,045 (GRCm38) missense probably benign 0.00
R7718:9530053A07Rik UTSW 7 28,147,201 (GRCm38) missense probably damaging 1.00
R7733:9530053A07Rik UTSW 7 28,139,965 (GRCm38) missense probably damaging 1.00
R7737:9530053A07Rik UTSW 7 28,157,073 (GRCm38) missense probably damaging 1.00
R7908:9530053A07Rik UTSW 7 28,147,496 (GRCm38) missense probably benign 0.12
R8013:9530053A07Rik UTSW 7 28,137,541 (GRCm38) missense probably benign 0.14
R8014:9530053A07Rik UTSW 7 28,137,541 (GRCm38) missense probably benign 0.14
R8151:9530053A07Rik UTSW 7 28,153,341 (GRCm38) missense possibly damaging 0.95
R8175:9530053A07Rik UTSW 7 28,164,448 (GRCm38) nonsense probably null
R8254:9530053A07Rik UTSW 7 28,147,349 (GRCm38) missense possibly damaging 0.63
R8345:9530053A07Rik UTSW 7 28,155,360 (GRCm38) missense probably damaging 1.00
R8414:9530053A07Rik UTSW 7 28,142,733 (GRCm38) missense probably damaging 1.00
R8419:9530053A07Rik UTSW 7 28,143,921 (GRCm38) missense probably damaging 1.00
R8496:9530053A07Rik UTSW 7 28,143,952 (GRCm38) missense possibly damaging 0.81
R8691:9530053A07Rik UTSW 7 28,153,839 (GRCm38) missense possibly damaging 0.72
R8785:9530053A07Rik UTSW 7 28,154,707 (GRCm38) missense probably damaging 1.00
R8863:9530053A07Rik UTSW 7 28,131,581 (GRCm38) missense probably damaging 1.00
R8926:9530053A07Rik UTSW 7 28,154,444 (GRCm38) missense probably damaging 1.00
R8950:9530053A07Rik UTSW 7 28,164,326 (GRCm38) missense probably benign 0.32
R9014:9530053A07Rik UTSW 7 28,155,451 (GRCm38) missense probably damaging 1.00
R9045:9530053A07Rik UTSW 7 28,154,431 (GRCm38) missense probably damaging 1.00
R9115:9530053A07Rik UTSW 7 28,154,329 (GRCm38) missense possibly damaging 0.74
R9233:9530053A07Rik UTSW 7 28,140,094 (GRCm38) missense possibly damaging 0.83
R9330:9530053A07Rik UTSW 7 28,156,985 (GRCm38) missense probably benign 0.02
R9426:9530053A07Rik UTSW 7 28,143,856 (GRCm38) missense possibly damaging 0.92
R9477:9530053A07Rik UTSW 7 28,152,840 (GRCm38) missense probably damaging 1.00
R9502:9530053A07Rik UTSW 7 28,137,466 (GRCm38) missense probably benign 0.09
R9505:9530053A07Rik UTSW 7 28,142,484 (GRCm38) nonsense probably null
R9601:9530053A07Rik UTSW 7 28,154,380 (GRCm38) missense possibly damaging 0.78
R9630:9530053A07Rik UTSW 7 28,137,199 (GRCm38) missense probably damaging 1.00
R9632:9530053A07Rik UTSW 7 28,142,301 (GRCm38) missense probably benign
R9673:9530053A07Rik UTSW 7 28,156,619 (GRCm38) missense probably benign 0.25
R9735:9530053A07Rik UTSW 7 28,157,010 (GRCm38) missense probably damaging 1.00
Z1176:9530053A07Rik UTSW 7 28,154,762 (GRCm38) missense probably benign 0.03
Z1176:9530053A07Rik UTSW 7 28,142,386 (GRCm38) missense probably benign 0.06
Z1177:9530053A07Rik UTSW 7 28,139,898 (GRCm38) missense probably benign 0.25
Z1186:9530053A07Rik UTSW 7 28,156,986 (GRCm38) missense probably benign 0.01
Z1186:9530053A07Rik UTSW 7 28,146,705 (GRCm38) missense probably benign 0.00
Z1186:9530053A07Rik UTSW 7 28,131,572 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGGCTTCACATTACACTACC -3'
(R):5'- AGGCCTCCTTACTCTAGGATTC -3'

Sequencing Primer
(F):5'- ACACTACCTTTGATGGCCG -3'
(R):5'- TGTTGAGGTCACACTTTCTCAC -3'
Posted On 2018-07-24