Mutagenetix > Incidental Mutation

Incidental Mutation 'R6699:Rrm1'

528686

Institutional Source

Beutler Lab

Gene Symbol

Rrm1

Ensembl Gene

ENSMUSG00000030978

Gene Name

ribonucleotide reductase M1

Synonyms

RnrM1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R6699 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102441695-102469771 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 102460825 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 556 (Y556N)

Ref Sequence

ENSEMBL: ENSMUSP00000033283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033283] [ENSMUST00000209630]

AlphaFold

P07742

Predicted Effect

probably damaging
Transcript: ENSMUST00000033283
AA Change: Y556N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033283
Gene: ENSMUSG00000030978
AA Change: Y556N

Domain	Start	End	E-Value	Type
Pfam:ATP-cone	1	89	8.7e-21	PFAM
Pfam:Ribonuc_red_lgN	141	213	2.8e-25	PFAM
Pfam:Ribonuc_red_lgC	216	738	1.6e-197	PFAM
coiled coil region	749	778	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209630

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209955

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210543

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211493

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211786

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.1%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large and catalytic subunit of ribonucleotide reductase, an enzyme essential for the conversion of ribonucleotides into deoxyribonucleotides. A pool of available deoxyribonucleotides is important for DNA replication during S phase of the cell cycle as well as multiple DNA repair processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic letahlity before E3.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	A	G	7: 28,144,368	T894A	probably damaging	Het
Adam39	A	G	8: 40,826,657	K695R	probably benign	Het
Agfg1	G	A	1: 82,858,454		probably null	Het
Ankrd44	G	A	1: 54,762,445	T241I	probably damaging	Het
Car15	T	C	16: 17,836,574	D166G	probably null	Het
Cpne2	G	A	8: 94,563,959	V391M	probably damaging	Het
Ddx27	C	T	2: 167,020,503	T155I	possibly damaging	Het
F830045P16Rik	T	C	2: 129,460,421	D417G	probably damaging	Het
Fam217b	T	G	2: 178,420,417	M58R	probably benign	Het
Ftmt	T	C	18: 52,331,665	S18P	possibly damaging	Het
Gm16494	C	T	17: 47,016,908	V17M	probably damaging	Het
Gm36864	A	T	7: 44,238,772	I342F	possibly damaging	Het
Grid2	C	G	6: 63,931,047	R224G	possibly damaging	Het
Hist1h4k	A	T	13: 21,750,504	M1K	probably null	Het
Hmgcr	T	C	13: 96,660,209	E191G	probably damaging	Het
Hrc	A	G	7: 45,335,695	D90G	possibly damaging	Het
Kbtbd7	A	G	14: 79,428,192	E488G	probably benign	Het
Krtap26-1	T	C	16: 88,647,715	N6S	unknown	Het
Mgat2	A	G	12: 69,184,781	D43G	probably damaging	Het
Mrps30	A	T	13: 118,380,598	S362T	probably damaging	Het
Olfr1124	A	T	2: 87,434,816	I110F	probably benign	Het
Olfr224	T	A	11: 58,567,205	I47L	possibly damaging	Het
Pcdhb11	T	A	18: 37,422,937	V440E	probably damaging	Het
Pcdhb18	T	A	18: 37,491,952	H778Q	probably benign	Het
Plekha7	T	C	7: 116,135,175	E1025G	probably damaging	Het
Rnf39	T	C	17: 36,947,229	W96R	probably damaging	Het
Rph3al	A	T	11: 75,900,837		probably benign	Het
Saal1	A	T	7: 46,692,817	C401S	probably damaging	Het
Sec14l3	T	C	11: 4,075,193	S268P	possibly damaging	Het
Tmem54	A	G	4: 129,111,325	I199M	probably benign	Het
Tomm70a	A	G	16: 57,142,802	M395V	probably benign	Het
Topors	A	G	4: 40,262,300	V328A	probably damaging	Het
Vmn2r61	T	G	7: 42,300,156	S667A	probably benign	Het
Vmn2r68	G	A	7: 85,232,375	A499V	possibly damaging	Het
Zcchc14	A	T	8: 121,608,616		probably benign	Het

Other mutations in Rrm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rrm1	APN	7	102454507	nonsense	probably null
IGL01431:Rrm1	APN	7	102457552	splice site	probably benign
IGL03251:Rrm1	APN	7	102457206	missense	probably damaging	1.00
IGL03401:Rrm1	APN	7	102465744	missense	possibly damaging	0.81
Arabica	UTSW	7	102460351	missense	probably damaging	1.00
Pentose	UTSW	7	102460856	splice site	probably null
R0454:Rrm1	UTSW	7	102466926	missense	probably damaging	1.00
R0548:Rrm1	UTSW	7	102467067	critical splice donor site	probably null
R0759:Rrm1	UTSW	7	102457561	missense	probably benign	0.32
R1575:Rrm1	UTSW	7	102456514	missense	probably damaging	1.00
R1586:Rrm1	UTSW	7	102466905	makesense	probably null
R1625:Rrm1	UTSW	7	102468347	missense	probably damaging	0.98
R2207:Rrm1	UTSW	7	102442026	start codon destroyed	probably null	0.98
R2432:Rrm1	UTSW	7	102443072	missense	probably benign	0.03
R2513:Rrm1	UTSW	7	102460689	missense	probably damaging	0.99
R3796:Rrm1	UTSW	7	102465703	splice site	probably null
R3914:Rrm1	UTSW	7	102457174	missense	probably damaging	1.00
R4179:Rrm1	UTSW	7	102457198	missense	probably damaging	1.00
R4302:Rrm1	UTSW	7	102447824	missense	probably benign	0.00
R4379:Rrm1	UTSW	7	102446593	missense	probably damaging	1.00
R4416:Rrm1	UTSW	7	102447801	missense	probably benign	0.06
R4690:Rrm1	UTSW	7	102447879	missense	probably benign
R4939:Rrm1	UTSW	7	102466924	missense	probably benign	0.34
R5433:Rrm1	UTSW	7	102465767	missense	probably damaging	0.97
R5445:Rrm1	UTSW	7	102451023	missense	possibly damaging	0.77
R6120:Rrm1	UTSW	7	102460856	splice site	probably null
R6198:Rrm1	UTSW	7	102446729	critical splice donor site	probably null
R6369:Rrm1	UTSW	7	102446702	missense	probably damaging	0.97
R7009:Rrm1	UTSW	7	102460334	missense	probably damaging	1.00
R7491:Rrm1	UTSW	7	102454557	missense	probably damaging	1.00
R8024:Rrm1	UTSW	7	102457265	missense	probably benign	0.00
R8276:Rrm1	UTSW	7	102460852	critical splice donor site	probably null
R8713:Rrm1	UTSW	7	102460351	missense	probably damaging	1.00
R8963:Rrm1	UTSW	7	102456532	missense	probably benign	0.23
R8968:Rrm1	UTSW	7	102468338	missense	probably benign	0.03
R9028:Rrm1	UTSW	7	102460398	missense	probably damaging	1.00
R9442:Rrm1	UTSW	7	102459391	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCGGCCCATTGGAATTGG -3'
(R):5'- CAGAACAGGGATTGCTGGATTTAG -3'

Sequencing Primer
(F):5'- CCCATTGGAATTGGGGTACAAG -3'
(R):5'- GGCGCACTTGAATAAATCTAGGCC -3'

Posted On

2018-07-24