Incidental Mutation 'R6699:Cpne2'
ID528689
Institutional Source Beutler Lab
Gene Symbol Cpne2
Ensembl Gene ENSMUSG00000034361
Gene Namecopine II
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R6699 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location94532990-94570531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 94563959 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 391 (V391M)
Ref Sequence ENSEMBL: ENSMUSP00000105163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048653] [ENSMUST00000109537]
Predicted Effect probably damaging
Transcript: ENSMUST00000048653
AA Change: V391M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045755
Gene: ENSMUSG00000034361
AA Change: V391M

DomainStartEndE-ValueType
C2 24 130 1.82e-9 SMART
C2 155 261 8.25e-8 SMART
low complexity region 269 278 N/A INTRINSIC
VWA 305 507 7.26e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109537
AA Change: V391M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105163
Gene: ENSMUSG00000034361
AA Change: V391M

DomainStartEndE-ValueType
C2 24 130 1.82e-9 SMART
C2 155 261 8.25e-8 SMART
low complexity region 269 278 N/A INTRINSIC
VWA 305 506 8.94e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156377
Predicted Effect probably benign
Transcript: ENSMUST00000212550
Meta Mutation Damage Score 0.2665 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encodes a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,144,368 T894A probably damaging Het
Adam39 A G 8: 40,826,657 K695R probably benign Het
Agfg1 G A 1: 82,858,454 probably null Het
Ankrd44 G A 1: 54,762,445 T241I probably damaging Het
Car15 T C 16: 17,836,574 D166G probably null Het
Ddx27 C T 2: 167,020,503 T155I possibly damaging Het
F830045P16Rik T C 2: 129,460,421 D417G probably damaging Het
Fam217b T G 2: 178,420,417 M58R probably benign Het
Ftmt T C 18: 52,331,665 S18P possibly damaging Het
Gm16494 C T 17: 47,016,908 V17M probably damaging Het
Gm36864 A T 7: 44,238,772 I342F possibly damaging Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Hist1h4k A T 13: 21,750,504 M1K probably null Het
Hmgcr T C 13: 96,660,209 E191G probably damaging Het
Hrc A G 7: 45,335,695 D90G possibly damaging Het
Kbtbd7 A G 14: 79,428,192 E488G probably benign Het
Krtap26-1 T C 16: 88,647,715 N6S unknown Het
Mgat2 A G 12: 69,184,781 D43G probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Olfr1124 A T 2: 87,434,816 I110F probably benign Het
Olfr224 T A 11: 58,567,205 I47L possibly damaging Het
Pcdhb11 T A 18: 37,422,937 V440E probably damaging Het
Pcdhb18 T A 18: 37,491,952 H778Q probably benign Het
Plekha7 T C 7: 116,135,175 E1025G probably damaging Het
Rnf39 T C 17: 36,947,229 W96R probably damaging Het
Rph3al A T 11: 75,900,837 probably benign Het
Rrm1 T A 7: 102,460,825 Y556N probably damaging Het
Saal1 A T 7: 46,692,817 C401S probably damaging Het
Sec14l3 T C 11: 4,075,193 S268P possibly damaging Het
Tmem54 A G 4: 129,111,325 I199M probably benign Het
Tomm70a A G 16: 57,142,802 M395V probably benign Het
Topors A G 4: 40,262,300 V328A probably damaging Het
Vmn2r61 T G 7: 42,300,156 S667A probably benign Het
Vmn2r68 G A 7: 85,232,375 A499V possibly damaging Het
Zcchc14 A T 8: 121,608,616 probably benign Het
Other mutations in Cpne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Cpne2 APN 8 94554753 missense possibly damaging 0.84
IGL02702:Cpne2 APN 8 94570023 missense probably benign 0.03
IGL03277:Cpne2 APN 8 94548372 missense probably benign 0.00
R0018:Cpne2 UTSW 8 94556053 missense possibly damaging 0.93
R0018:Cpne2 UTSW 8 94556053 missense possibly damaging 0.93
R0126:Cpne2 UTSW 8 94554933 missense probably damaging 1.00
R0135:Cpne2 UTSW 8 94554925 unclassified probably benign
R0167:Cpne2 UTSW 8 94568579 unclassified probably benign
R0661:Cpne2 UTSW 8 94556039 missense possibly damaging 0.78
R0671:Cpne2 UTSW 8 94548342 start gained probably benign
R4691:Cpne2 UTSW 8 94558221 missense probably damaging 0.99
R4856:Cpne2 UTSW 8 94563964 missense probably benign 0.00
R4886:Cpne2 UTSW 8 94563964 missense probably benign 0.00
R6632:Cpne2 UTSW 8 94554955 missense probably benign 0.00
R6968:Cpne2 UTSW 8 94548502 missense probably damaging 1.00
R7117:Cpne2 UTSW 8 94555544 missense probably damaging 1.00
R7505:Cpne2 UTSW 8 94548466 missense possibly damaging 0.90
R7571:Cpne2 UTSW 8 94551780 missense probably benign
R7583:Cpne2 UTSW 8 94555581 missense probably benign
R7612:Cpne2 UTSW 8 94557420 missense probably benign 0.01
R7745:Cpne2 UTSW 8 94568684 missense probably damaging 1.00
R7845:Cpne2 UTSW 8 94551204 missense probably benign 0.16
R7928:Cpne2 UTSW 8 94551204 missense probably benign 0.16
R8278:Cpne2 UTSW 8 94554688 missense probably damaging 1.00
R8319:Cpne2 UTSW 8 94553412 missense probably benign 0.01
X0025:Cpne2 UTSW 8 94557451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTAGGCTCTTGAGTATGCC -3'
(R):5'- AGAGCACACATCCCGATCTG -3'

Sequencing Primer
(F):5'- AGGCTCTTGAGTATGCCCTTAGC -3'
(R):5'- GTGCCACCCACAGCTAG -3'
Posted On2018-07-24