Incidental Mutation 'R6699:Kbtbd7'
ID528698
Institutional Source Beutler Lab
Gene Symbol Kbtbd7
Ensembl Gene ENSMUSG00000043881
Gene Namekelch repeat and BTB (POZ) domain containing 7
Synonyms1110008P08Rik, LOC211255
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6699 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location79426511-79431036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79428192 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 488 (E488G)
Ref Sequence ENSEMBL: ENSMUSP00000060768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022600] [ENSMUST00000061222]
Predicted Effect probably benign
Transcript: ENSMUST00000022600
SMART Domains Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022

DomainStartEndE-ValueType
low complexity region 104 119 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
PCRF 139 255 5.96e-27 SMART
Pfam:RF-1 290 400 2.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061222
AA Change: E488G

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000060768
Gene: ENSMUSG00000043881
AA Change: E488G

DomainStartEndE-ValueType
Blast:BTB 11 44 2e-11 BLAST
BTB 63 168 1.05e-23 SMART
BACK 173 279 1.41e-19 SMART
low complexity region 317 340 N/A INTRINSIC
Pfam:Kelch_1 434 481 1.7e-9 PFAM
low complexity region 657 676 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional activator, having been shown to increase the transcription of activator protein-1 and serum response element. The encoded protein can also form a complex with KBTBD6 and CUL3, which regulates the ubiquitylation and degradation of TIAM1, which is a regulator of RAC1. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,144,368 T894A probably damaging Het
Adam39 A G 8: 40,826,657 K695R probably benign Het
Agfg1 G A 1: 82,858,454 probably null Het
Ankrd44 G A 1: 54,762,445 T241I probably damaging Het
Car15 T C 16: 17,836,574 D166G probably null Het
Cpne2 G A 8: 94,563,959 V391M probably damaging Het
Ddx27 C T 2: 167,020,503 T155I possibly damaging Het
F830045P16Rik T C 2: 129,460,421 D417G probably damaging Het
Fam217b T G 2: 178,420,417 M58R probably benign Het
Ftmt T C 18: 52,331,665 S18P possibly damaging Het
Gm16494 C T 17: 47,016,908 V17M probably damaging Het
Gm36864 A T 7: 44,238,772 I342F possibly damaging Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Hist1h4k A T 13: 21,750,504 M1K probably null Het
Hmgcr T C 13: 96,660,209 E191G probably damaging Het
Hrc A G 7: 45,335,695 D90G possibly damaging Het
Krtap26-1 T C 16: 88,647,715 N6S unknown Het
Mgat2 A G 12: 69,184,781 D43G probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Olfr1124 A T 2: 87,434,816 I110F probably benign Het
Olfr224 T A 11: 58,567,205 I47L possibly damaging Het
Pcdhb11 T A 18: 37,422,937 V440E probably damaging Het
Pcdhb18 T A 18: 37,491,952 H778Q probably benign Het
Plekha7 T C 7: 116,135,175 E1025G probably damaging Het
Rnf39 T C 17: 36,947,229 W96R probably damaging Het
Rph3al A T 11: 75,900,837 probably benign Het
Rrm1 T A 7: 102,460,825 Y556N probably damaging Het
Saal1 A T 7: 46,692,817 C401S probably damaging Het
Sec14l3 T C 11: 4,075,193 S268P possibly damaging Het
Tmem54 A G 4: 129,111,325 I199M probably benign Het
Tomm70a A G 16: 57,142,802 M395V probably benign Het
Topors A G 4: 40,262,300 V328A probably damaging Het
Vmn2r61 T G 7: 42,300,156 S667A probably benign Het
Vmn2r68 G A 7: 85,232,375 A499V possibly damaging Het
Zcchc14 A T 8: 121,608,616 probably benign Het
Other mutations in Kbtbd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Kbtbd7 APN 14 79428612 missense probably damaging 0.98
IGL01364:Kbtbd7 APN 14 79428046 missense possibly damaging 0.82
R0973:Kbtbd7 UTSW 14 79427430 missense possibly damaging 0.48
R0973:Kbtbd7 UTSW 14 79427430 missense possibly damaging 0.48
R0974:Kbtbd7 UTSW 14 79427430 missense possibly damaging 0.48
R1236:Kbtbd7 UTSW 14 79427832 missense probably benign 0.05
R2909:Kbtbd7 UTSW 14 79428482 missense probably benign 0.16
R4731:Kbtbd7 UTSW 14 79428800 makesense probably null
R4732:Kbtbd7 UTSW 14 79428800 makesense probably null
R4733:Kbtbd7 UTSW 14 79428800 makesense probably null
R4984:Kbtbd7 UTSW 14 79427162 missense probably damaging 1.00
R5712:Kbtbd7 UTSW 14 79428765 missense possibly damaging 0.86
R7122:Kbtbd7 UTSW 14 79428317 missense probably damaging 0.98
R7176:Kbtbd7 UTSW 14 79427754 missense possibly damaging 0.77
R7457:Kbtbd7 UTSW 14 79427924 frame shift probably null
R7875:Kbtbd7 UTSW 14 79427366 missense probably benign 0.04
R8041:Kbtbd7 UTSW 14 79428704 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CTATGGGTGTATAAACCAGCCC -3'
(R):5'- TGTAGACCTTCATGACTGGGATG -3'

Sequencing Primer
(F):5'- CAAAATAGTTGGCATCAGCTGG -3'
(R):5'- GGGATGTCACAGATACAATAGATTTC -3'
Posted On2018-07-24